Báo cáo khoa học: "Conserved positive selection signals in gp41 across multiple subtypes and difference in selection signals detectable in gp41 sequences sampled during acute and chronic HIV-1 subtype C infection" potx

Báo cáo khoa học: "Conserved positive selection signals in gp41 across multiple subtypes and difference in selection signals detectable in gp41 sequences sampled during acute and chronic HIV-1 subtype C infection" potx

Báo cáo khoa học: "Conserved positive selection signals in gp41 across multiple subtypes and difference in selection signals detectable in gp41 sequences sampled during acute and chronic HIV-1 subtype C infection" potx

... Journal Open Access Research Conserved positive selection signals in gp41 across multiple subtypes and difference in selection signals detectable in gp41 sequences sampled during acute and chronic HIV-1 ... hypothesis we compared selection signals detectable by various methods in the subtype- C acute infection (AI) and chronic inf...

Ngày tải lên: 12/08/2014, 04:21

16 242 0
Báo cáo khoa học: Rapamycin inhibits lipopolysaccharide induction of granulocyte-colony stimulating factor and inducible nitric oxide synthase expression in macrophages by reducing the levels of octamer-binding factor-2 doc

Báo cáo khoa học: Rapamycin inhibits lipopolysaccharide induction of granulocyte-colony stimulating factor and inducible nitric oxide synthase expression in macrophages by reducing the levels of octamer-binding factor-2 doc

... ACTTGGGATGCTCCATGGTC Mouse G-CSF Forward CTCAACTTTCTGCCCAGAGG Reverse CTGGAAGGCAGAAGTGAAGG Human G-CSF Forward CACTCTGGACAGTGCAGGAAG Reverse CGACACCTCCAGGAAGCTCTG GAPDH a Forward AAAGGATCCACTGGCGTCTTCACCACC Reverse ... Forward ACGCGTAGATCCAACACCCTGCAGCGAT Reverse AGATCTGATTCTGGGTGATCTGGGCTGCA Oligonucleotides used for RT-PCR Oct-2 a Forward AATGGACCCGACATTAACCA Reverse AAATGGTCGTTTGGCTGAAG iN...

Ngày tải lên: 22/03/2014, 17:20

12 377 0
Báo cáo khoa học: Molecular characterization of gonad-inhibiting hormone of Penaeus monodon and elucidation of its inhibitory role in vitellogenin expression by RNA interference pptx

Báo cáo khoa học: Molecular characterization of gonad-inhibiting hormone of Penaeus monodon and elucidation of its inhibitory role in vitellogenin expression by RNA interference pptx

... as-GIHF-SalI (5¢-CGGTCGACAACATCCTGGACAGCA-3¢) and as- GIHR-BamHI (5¢-CGGGATCCTCACCACGGCCGG CCGGC-3¢). The antisense template was first cloned into pET17b vector at BamHI and XhoI sites, following by the sense ... after incubating with GIH-dsRNA. This silencing was not affected by irrelevant dsRNA, thus indicating that Pem-GIH knockdown occurred in a sequence-speci c fashion. Similar spe...

Ngày tải lên: 23/03/2014, 07:20

11 369 0
Báo cáo khoa học: "Why Initialization Matters for IBM Model 1: Multiple Optima and Non-Strict Convexity" pptx

Báo cáo khoa học: "Why Initialization Matters for IBM Model 1: Multiple Optima and Non-Strict Convexity" pptx

... al.’s claim is in fact incorrect. Furthermore, we will empirically show in Sections 4 and 5 that multiple distinct pa- rameter values can achieve the global optimum of the objective function, which ... 2002. Object recognition as machine translation: Learning a lexicon for a fixed image vocabulary. In Proceedings of ECCV. Volker Kaibel, Marc E. Pfetsch, and TU Berlin. 2002. Some al...

Ngày tải lên: 23/03/2014, 16:20

6 347 0
Báo cáo khoa học: " Comparison of a small volume of hypertonic saline solution and dextran 40 on hemodynamic alternations in conscious calves" ppsx

Báo cáo khoa học: " Comparison of a small volume of hypertonic saline solution and dextran 40 on hemodynamic alternations in conscious calves" ppsx

... mmHg/l/min) and pulmonary vascular resistance (PVR: [PAP/CO] × 80, mmHg/l/min) were calculated [14]. Venous samples were collected at each recording point and used to determine hemoglobin concentration ... addition, CO remained higher in the treatment with D40 than that with Lactated Ringer’s [10]. In the present, D40 infusion induced significant increases in CO, CI and SV, reachi...

Ngày tải lên: 07/08/2014, 18:21

6 366 0
Báo cáo khoa học: "Treatment results for hypopharyngeal cancer by different treatment strategies and its secondary primary- an experience in Taiwan" pptx

Báo cáo khoa học: "Treatment results for hypopharyngeal cancer by different treatment strategies and its secondary primary- an experience in Taiwan" pptx

... tract (including oral cavity, pharynx, esophagus and lung) is the most common cancer that occurs in Taiwanese man, and the incidence of oral cavity cancer and eso- phageal cancer is increasing ... Taiwan. 7 Graduate Institute of Clinical Medical Science, Chang Gung University, Taoyuan, Taiwan. Authors’ contributions MFC and JTC designed and coordinated the study. Patient accrual...

Ngày tải lên: 09/08/2014, 09:20

8 256 0
báo cáo khoa học: "A cytogenetic survey was carried out on fattening male and female pigs of different lines in a local herd and on " ppsx

báo cáo khoa học: "A cytogenetic survey was carried out on fattening male and female pigs of different lines in a local herd and on " ppsx

... monocentric translocation occurred earlier in the Landrace of GDR. The increased local use of an aberrant boar in artificial insemination can lead to higher frequency, as ... translocation in swine M. SCHWERIN, D. GOLISCH E. RITTER Research Centre of Animal Production Dummerstorf-Rostock, 2551 Dummerstorf German Democratic Republic Summary A cytogeneti...

Ngày tải lên: 09/08/2014, 22:22

7 313 0
Báo cáo khoa học: Conserved residues in the N-domain of the AAA+ chaperone ClpA regulate substrate recognition and unfolding pdf

Báo cáo khoa học: Conserved residues in the N-domain of the AAA+ chaperone ClpA regulate substrate recognition and unfolding pdf

... manner. In contrast to the Fig. 1. Multiple sequence alignment of the N-domain of bacterial ClpA homologues and E. coli ClpB. Amino acid sequences of the N-domain of ClpA from E. coli (P0ABH9), V. cholera ... two elements in ClpA, one in the N-domain and the other in the pore of the ClpA hexamer. In the case of short unstructured peptides or unfolded proteins such as casein,...

Ngày tải lên: 07/03/2014, 05:20

11 434 0
Báo cáo khoa học: Conserved structural determinants in three-fingered protein domains pdf

Báo cáo khoa học: Conserved structural determinants in three-fingered protein domains pdf

... CA a1 CB a1 , CA a2 CB a1 ,CA a1 CB a2 and CA a2 CB a2 , where CA a1 is the a-carbon of the N-terminal cysteine residue in cystine A, CB a1 is the same atom in the N-terminal cysteine residue in cystine ... speci c to cer- tain classes of TFPD (Fig. 2), such as B2a which occurs in long neurotoxins and B3a which is found in Act-RII. B1a is a more common feature and can be seen...

Ngày tải lên: 07/03/2014, 06:20

19 401 0
Báo cáo khoa học: Conserved pore-forming regions in polypeptidetransporting proteins pot

Báo cáo khoa học: Conserved pore-forming regions in polypeptidetransporting proteins pot

... of motif 3 (A, B) and motif 4 (C, D) were calculated according to [11]. The values of the region including the 10 amino acids in front and behind the motifs are shown. Black lines show the average ... the fraction of random strings that have match scores bigger or equal than the score of the putative motif in the target sequence. The threshold to select sequences containing a speci...

Ngày tải lên: 16/03/2014, 18:20

12 228 0
w