Báo cáo khoa học: " Hepatitis C Virus entry: the early steps in the viral replication cycle" ppt

Báo cáo khoa học: " Hepatitis C Virus entry: the early steps in the viral replication cycle" ppt

Báo cáo khoa học: " Hepatitis C Virus entry: the early steps in the viral replication cycle" ppt

... possible the study of the HCV replication cycle, in vitro. Studies utilizing the HCVpp and HCVcc systems have increased our insight into the early steps of the viral replication cycle of HCV, such ... the HCV replication cycle was hampered due to difficulties in growing and propagating the virus in an in vitro setting. The advent of the HCV pseudo parti...

Ngày tải lên: 12/08/2014, 04:21

11 345 0
Báo cáo khoa học: " Hepatitis C virus core protein induces apoptosis-like caspase independent cell death" docx

Báo cáo khoa học: " Hepatitis C virus core protein induces apoptosis-like caspase independent cell death" docx

... absence of tetracycline to induce specific protein expressionFigure 3 Different features of apoptosis induced by the HCV-core protein in UC cells cultured in the presence or absence of tetracycline ... investigate whether the HCV core protein exerts an enhancing effect on the activation of the death Different features of apoptosis induced by the HCV-core protein in UC cells...

Ngày tải lên: 12/08/2014, 04:21

13 284 0
Báo cáo khoa học:" Hepatitis C virus NS4B carboxy terminal domain is a membrane binding domain" docx

Báo cáo khoa học:" Hepatitis C virus NS4B carboxy terminal domain is a membrane binding domain" docx

... expression constructs NS4B FL Forward primer, GTGGGTACCATGTCACACCTCCCTTACATCGAACAG Reverse primer, TAGTCTAGAGAGCCGGAGCATGGCGTGGAGCAGTC NS4B-CTD Forward primer, GTGGGTACCATGGCGATACTGCGTCGGCACGTGGGC Reverse ... This indicates that membrane association is not affected by the suggested RNA binding characteristics of the domain in the presence of RNA. Clearly, the HCV life cycle is achie...

Ngày tải lên: 12/08/2014, 04:21

12 307 0
Báo cáo khoa học: " Hepatitis C Virus infection in apparentenly healthy individuals with family history of diabetes in Vom, Plateau State Nigeria" ppsx

Báo cáo khoa học: " Hepatitis C Virus infection in apparentenly healthy individuals with family history of diabetes in Vom, Plateau State Nigeria" ppsx

... over-looking the economic significance of their ill health, assuming they progress to cirrhotic HCV or develop hepatocelluar carcinoma due to HCV chronicity. Background Hepatitis C virus (HCV) infection ... also increases the rate of HCV replication. Plasma levels of pro inflammatory cytokines like tumor necrosis factor- alpha are increased in acute alcoholic hep- atitis and suc...

Ngày tải lên: 12/08/2014, 04:21

6 291 0
Báo cáo khoa học: "Hepatitis C virus NS4B carboxy terminal domain is a membrane binding domain" pps

Báo cáo khoa học: "Hepatitis C virus NS4B carboxy terminal domain is a membrane binding domain" pps

... expression constructs NS4B FL Forward primer, GTGGGTACCATGTCACACCTCCCTTACATCGAACAG Reverse primer, TAGTCTAGAGAGCCGGAGCATGGCGTGGAGCAGTC NS4B-CTD Forward primer, GTGGGTACCATGGCGATACTGCGTCGGCACGTGGGC Reverse ... FL NS4B-deltaCTD Forward primer, as NS4B FL Reverse primer, TAGTCTAGAGACCGACGCAGTATCGCTGCGCACACGAC NS4B-CTD sub-Cys Forward primer, as for NS4B-CTD Reverse primer, AGATCTAGAGAGCCGGAGGATG...

Ngày tải lên: 12/08/2014, 04:21

12 214 0
Báo cáo khoa học: " Hepatitis C Virus infection in apparentenly healthy individuals with family history of diabetes in Vom, Plateau State Nigeria" pot

Báo cáo khoa học: " Hepatitis C Virus infection in apparentenly healthy individuals with family history of diabetes in Vom, Plateau State Nigeria" pot

... over-looking the economic significance of their ill health, assuming they progress to cirrhotic HCV or develop hepatocelluar carcinoma due to HCV chronicity. Background Hepatitis C virus (HCV) infection ... pro inflammatory cytokines like tumor necrosis factor- alpha are increased in acute alcoholic hep- atitis and such cytokines induce insulin resistance and glucose intolerance whi...

Ngày tải lên: 12/08/2014, 04:22

6 245 0
Báo cáo y học: "Hepatitis C Virus (HCV) Infection and Hepatic Steatosis"

Báo cáo y học: "Hepatitis C Virus (HCV) Infection and Hepatic Steatosis"

... virus, in and of itself, can directly induce cytoplasmic lipid accumulation. Further studies examining the genotype 3 virus are warranted to further recognize the process involved in HCV-induced ... [26] The core protein has been located at the surface of lipid droplets within the cytoplasm in cell cultures that are transfected with HCV while absent in control cells...

Ngày tải lên: 02/11/2012, 09:51

4 438 0
Báo cáo y học: "Hepatitis C Virus Serologic and Virologic Tests and Clinical Diagnosis of HCVRelated Liver Disease"

Báo cáo y học: "Hepatitis C Virus Serologic and Virologic Tests and Clinical Diagnosis of HCVRelated Liver Disease"

... used in molecular epidemiology studies, where exact subtyping is needed. In clinical practice, HCV genotype can be determined by various commercial kits, using direct sequence analysis of the ... mis-subtyping may occur in 10 to 25% of cases, related to the studied region (5’ noncoding region) rather than the technique used. These errors have no clinical consequences, becaus...

Ngày tải lên: 02/11/2012, 09:56

6 612 0
Từ khóa:
w