Báo cáo khoa học: "Diversification of West Nile virus in a subtropical region" pptx
... 2 nd (1632–2459) 5'-CCTTGGAGCAGTGCTGGAAGTA-3' (1636–1657) 5'-TTCACGGAGAGGAAGAGCAGAA-3' (2438–2459) NS3 1 st (5085–5908) 5'-CGGCTCATACATAAGCGCGAT-3' (5085–5105) 5'-TTGGTTTCACACTCTTCCGGC-3' (5888–5908) NS3 ... findings expand our understanding of the temporal and spatial compartmentalization of West Nile virus subtypes within North America. It w...
Ngày tải lên: 12/08/2014, 04:21
... 2 nd (5514–6318) 5'-TTCCACAAAGGTCGAGCTAGG-3' (5514–5534) 5'-CCTAGGACCATCAAAGCACCA-3' (6298–6318) NS3 3 rd (5950–6726) 5'-CCATCTGCAGTGACAGCAGCTA-3' (5950–5971) 5'-TTCGTTCCTGGAACTTCAGCC-3' (6756–6776) Primer ... Taken together, these findings expand our understanding of the temporal and spatial compartmentalization of West Nile virus subtypes wi...
Ngày tải lên: 12/08/2014, 04:22
... he was afebrile (temperature of 36.5°C) and hemodynamically stable. Neurological examination revealed flaccid paralysis of the right leg and absent patellar and ankle reflexes. The remainder of ... of the cauda equina and nerve roots of the lumbosacral spine. Serum IgM was positive for West Nile virus and EMG was consistent with multiple root inflammation of the cauda equina...
Ngày tải lên: 10/08/2014, 23:20
Tài liệu Báo cáo khoa học: Roles of heat shock factors in gametogenesis and development pptx
... M, Sugahara K, Nakahari T, Yonemura S, Tanaka Y, Hayashida N, Inouye S, Takemoto T, Yamashita H et al. (2006) Maintenance of olfactory neurogenesis requires HSF1, a major heat shock transcription ... L, Jin Y, Shi Y, Chu R, Ban A, Eiberg H, Andres L, Jiang H, Zheng G, Qian M et al. (2002) Mutant DNA-binding domain of HSF4 is associated with autosomal dominant lamellar and Marner cata-...
Ngày tải lên: 18/02/2014, 04:20
Tài liệu Báo cáo khoa học: Destabilization of psychrotrophic RNase HI in a localized fashion as revealed by mutational and X-ray crystallographic analyses pdf
... extension: tailor-made genes using the polymerase chain reaction. Biotechniques 8, 528–535. 34 Kanaya S, Katsuda C, Kimura S, Nakai T, Kitakuni E, Nakamura H, Katayanagi K, Morikawa K & Ikehara M ... psychrotrophic RNase HI in a localized fashion as revealed by mutational and X-ray crystallographic analyses Muhammad S. Rohman 1 , Takashi Tadokoro 1 , Clement Angkawidjaja 1 , Yumi Abe...
Ngày tải lên: 18/02/2014, 13:20
Báo cáo khoa học: Prediction of missing enzyme genes in a bacterial metabolic network Reconstruction of the lysine-degradation pathway ofPseudomonas aeruginosa doc
... cloning of PA0266 were as follows: 5’-GGAATTCCATATGAGCAAGACCAACG AATCCC-3’ and 5’-CCGCTCGAGAGCGAGTTCGTCG AAGCACTCGG-3’. PCR was performed using KOD-plus DNA polymerase (Toyobo Co., Ltd, Osaka, Japan) ... pathway in P. aeruginosa using EC number information. As a result, we identified PA0266 as a putative 5-aminovalerate aminotransferase (EC 2.6.1.48) and PA0265 as a putative glutarat...
Ngày tải lên: 07/03/2014, 09:20
báo cáo khoa học: "Evolution of T-cell clonality in a patient with Ph-negative acute lymphocytic leukemia occurring after interferon and imatinib therapy for Ph-positive chronic myeloid leukemia" pot
... (downstream) 5’-TCAGACCCTGAGGCTCAAAGTC-3’ CML 3 (upstream) 5’-CGCATGTTCCGGGACAAAAGC-3’ Wang et al. Journal of Hematology & Oncology 2010, 3:14 http://www.jhoonline.org/content/3/1/14 Page 3 of ... human melanomas. J Immunol 1994, 153:2807-2818. 25. Fayad L, Kantarjian H, O’Brien S, Seong D, Albitar M, Keating M, Talpaz M: Emergence of new clonal abnormalities following interferon-al...
Ngày tải lên: 10/08/2014, 22:21
Báo cáo khoa học: "Description of the Infection Status in a Norwegian Cattle Herd Naturally Infected by Mycobacterium avium subsp. paratuberculosis." potx
... epidemio- logical confirmation and circumstances of occur- rence of sheep (S) strains of Mycobacterium avium subsp. paratuberculosis in cases of paratu- berculosis in cattle in Australia and sheep and cat- tle ... and serological, pathological, and bacteriological examination. Material and Methods Farm management The farm was located in Hordaland-county in Western Norway. Du...
Ngày tải lên: 12/08/2014, 15:21
Báo cáo sinh học: " Actively replicating West Nile virus is resistant to cytoplasmic delivery of siRNA" ppt
... RNA Name Virus Start Nucleotide Target Sequence Cap WNV Lineage I 312 gaacaaacaaacagcgatgaa Cap-Mut WNV Lineage I 312 gaagaaagaaagaccgatgaa M2 Influenza A M2 18 ggtcgaaacgcctatcagaaa 3110 WNV Lineage ... WNV Lineage I 5497 gcagcaagaggttacattt 6337 WNV Lineage II 6337 gttgaagtcatcacgaagt 6349 WNV Lineage I 6349 gtggaagtcatcacgaagc 6915 WNV Lineage I 6915 caacgagatgggttggcta 7353 WNV Lineag...
Ngày tải lên: 19/06/2014, 08:20
báo cáo hóa học:" Actively replicating West Nile virus is resistant to cytoplasmic delivery of siRNA" pptx
... onset of WNV RNA Table 1: Small interfering RNA Name Virus Start Nucleotide Target Sequence Cap WNV Lineage I 312 gaacaaacaaacagcgatgaa Cap-Mut WNV Lineage I 312 gaagaaagaaagaccgatgaa M2 Influenza ... 8898 cagcaatgcagctttgggt 9095 WNV Lineage I 9095 gaagcagagccatttggtt 9607 WNV Lineage I 9607 gggaaaggacccaaagtca 10355 WNV Lineage I 10355 gagagatatgaagacacaac siRNA were generated against 1...
Ngày tải lên: 20/06/2014, 04:20