0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Báo cáo y học: "Development and Validation of a HPV-32 Specific PCR Assay" pps

Báo cáo y học:

Báo cáo y học: "Development and Validation of a HPV-32 Specific PCR Assay" pps

... Developed and ran the HPV-32 specific PCR assay,did all statistical analysis, and prepared the manu-script.NH: Extracted the clinical samples and tested themvia the PGMY and HPV-32 dot blot assay. ... HPV-32 specific PCR assay has a sensitivity of 95.8% and 88.9% by sample and subject,respectively, and specificity was 87.8% and 58.8% by sample and subject, respectively. The lowsensitivity is ... positive samples were identified that were neg-ative by the dot blot assay. The HPV-32 type specific PCR assay has a sensitivity of 95.8% and a specificity of 87.8%with a kappa of 0.32 ± 0.029 as...
  • 7
  • 424
  • 0
Báo cáo y học:

Báo cáo y học: " Development and validation of a complementary map to enhance the existing 1998 to 2008 Abbreviated Injury Scale map" doc

... Palmer et al.: Development and validation of a complementary map to enhance the existing 1998 to 2008 AbbreviatedInjury Scale map. Scandinavian Journal of Trauma, Resuscitation and Emergency ... of tra uma against current trau mamanagement standards requires that data be converted(’mapped’) to AIS08. The goal of mapping AIS98-codeddata to AIS08 is to produce an accurate estimate of ... cameron.palmer@rch.org.au1Trauma Service, The Royal Children’s Hospital Melbourne, AustraliaFull list of author information is available at the end of the articlePalmer et al. Scandinavian Journal of Trauma,...
  • 13
  • 688
  • 0
Báo cáo y học:

Báo cáo y học: "Development and validation of the self-administered Fibromyalgia Assessment Status: a disease-specific composite measure for evaluating treatment effect" pptx

... greater sensitivity butlower specificity, whereas a cut-off value of 4.6 gave a sensi-tivity of 58.7% with a specificity of 91.9%.Reliability analysisThe reliability of the FAS index was evaluated ... non-ran-domised primary care sample. It can be assumed that the moti-vation of patients who volunteer to take part in a study isdifferent from that of a random population, and they may have a ... women and 17 men)with a mean age of 52.1 ± 10.8 years (range 20 to 75), a meanduration of symptoms of 10.5 ± 9.7 years (range 1 to 28), a mean TPS of 15.1 ± 2.4 (range 11 to 18), and a mean painArthritis...
  • 12
  • 423
  • 0
Báo cáo y học:

Báo cáo y học: "Development and validation of an ELISA using a protein encoded by ORF2 antigenic domain of porcine circovirus type 2" ppsx

... a median value of 31.74%. These data showed that the assay was repeatable and yielded a low and acceptable variation.Evaluation of assay specificity and sensitivityThe PCV2 GST-ORF2-E ELISA ... Laboratory of Veterinary Etiological Biology, Key Laboratory of Animal Virology of Ministry of Agriculture, Lanzhou Veterinary ResearchInstitute, Chinese Academy of Agricultural Sciences, Xujiaping ... contrast, enzyme linked immu nosorbentassay (ELISA) can decrease the potential bias that mayoccur with IFA and IPMA and is amenable to automa-tion, so it is suitable for large-scale diagnostics.Recently,...
  • 7
  • 420
  • 0
Báo cáo y học:

Báo cáo y học: "Development and validation of molecular markers for characterization of Boehmeria nivea var. nivea and Boehmeria nivea var. tenacissima" pps

... Sn-S62 -a CGACAGTAAACATAAAAACCG 1 1*Sn-S62-b CTGTTACCATTGGCTCTTTACCCAPS 60-67 CP-S62-f TCGTGCGGGTCATAGTACCCCGAGACAAGAGGCCAAAA 2 0.25, 0.3(Afl III)CP-S62-r TGTAATACGAAAGTTTAAGTCTCTTTTCTTAGTC 0.2, ... CTCTTGAGCAATCCAAATGTTTTGTTATCASR-S343-R1 CATAAATCACTTTATAACATAACGAGCTCGTATT 1 1.03SR-S343-R2 CGCGACAGAGGGGTTTTCTTTCTATTA 1 0.95SR-S343-R3 AGACGCCTCACTTTGATAGACATGAGTTTA 1 0.89SNP 50-60 Sn-S62 -a ... F1/R3R2nivea var. veaB. nivea var. tenacissima B. nivea var. niveaCd TC NC CY1 CY2 HCd TC NCFigure 2 SCAR band patterns of B. nivea var. te nacissima and B. nivea var. nivea. SCAR profiles of...
  • 9
  • 352
  • 0
báo cáo hóa học:

báo cáo hóa học: " Development and validation of a preference based measure derived from the Cambridge Pulmonary Hypertension Outcome Review (CAMPHOR) for use in cost utility analyses" doc

... JRdesigned and managed the valuation survey, conductedanalysis and reported on the valuation exercise. *DM ranthe analysis to identify items for the valuation exercise,analysed the validation data and ... writ-ing of the manuscript. JB designed and managed the valu-ation survey, analysed and reported on the valuation data and contributed to the writing of the manuscript. Allauthors read and approved ... respectively.Table 5 presents examples comparing the predicted valuesaccording to each model and the actual values for eachhealth state. Validation of the preference based CAMPHOR scale A majority...
  • 8
  • 590
  • 0
báo cáo hóa học:

báo cáo hóa học: " Development and validation of a French patient-based health-related quality of life instrument in kidney transplant: the ReTransQoL" pot

... Fujisawa M, Ichikawa Y, Yoshiya K, Isotani S, Higuchi A, Nagano S,Arakawa S, Hamami G, Matsumoto O, Kamidono S: Assessment of health-related quality of life in renal transplant and hemodi-alysis ... Ortega F, Baltar JM, Díaz-Corte C, Navascués RA, NavesM, Ure a A, Bad a X, Alvarez-Ude F, Alvarez-Grande J: Healthrelated quality of life (HRQOL) of kidney transplantedpatients : variables that ... Berland2 and Roland Sambuc1Address: 1Department of Public Health, EA 3279, University of Aix-Marseille II, France and 2Department of Nephrology and Kidney Transplantation, Hospital Conception,...
  • 12
  • 520
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " Development and validation of a Greek language version of the Manchester Foot Pain and Disability Index" docx

... citation purposes)Health and Quality of Life OutcomesOpen AccessResearchDevelopment and validation of a Greek language version of the Manchester Foot Pain and Disability IndexPatricia Kaoulla1, ... in a pop-ulation-based survey of foot pain [13] as an outcomemeasure in a clinical trial [14] and as a measure of footpain in people with Ehlers-Danlos syndrome [15] and early rheumatoid arthritis ... and validation of a questionnaire designed to measure foot-health status. J Am Podiatr Med Assoc 1998, 88:419-428.11. Garrow AP, Papageorgiou AC, Silman AJ, Thomas E, Jayson MIV, Mac-farlane...
  • 9
  • 481
  • 0
báo cáo hóa học:

báo cáo hóa học:" Development and validation of a psychosocial screening instrument for cancer" potx

... Canada and 3Health Care and Epidemiology, University of British Columbia, CanadaEmail: Wolfgang Linden* - wlinden@psych.ubc.ca; Dahyun Yi - dyi@hotmail.com; Maria Cristina Barroetavena - mbarroet@bccancer.bc.ca; ... evidence of validity. Finally, raw means and standard deviations are provided for each cancer type and each gender group (Table 4). This presentationalapproach appeared more parsimonious and provided ... highly disease -specific measure because many distress-ing physical aspects of cancer (like pain and functionallimitations) are only salient in late stage cancer and are,fortunately, of limited...
  • 7
  • 463
  • 0
Báo cáo y học:

Báo cáo y học: " Development and evaluation of a tool for the assessment of footwear characteristics" pdf

... range of each measure across included footwear was alsoreported. Intra-rater and inter-rater reliability for all cate-gorical data was evaluated using percentage agreement, and kappa (κ) statistics ... Inter-rater reliability for categorical measures.% agreement KappaVariable Day 1 Day 2 Day 1 Day 2FitAdequate length (palpation) 88 83 0.59 0.66Adequate length (straw method) 97 90 0.93 0.79Adequate ... mid-soles, lateral and medial midsole hardness items werecombined for data analysis. Intra-rater and inter-rater reli-ability for all continuous data were evaluated using intra-class correlation...
  • 12
  • 379
  • 0

Xem thêm

Từ khóa: báo cáo y họcbáo cáo y học cổ truyềnmẫu báo cáo y học cổ truyềnbao cao y hoc colchicinphan ban luan trong bao cao y hoc co truyendevelopment and use of a risk reference frameworkBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Báo cáo quy trình mua hàng CT CP Công Nghệ NPVchuyên đề điện xoay chiều theo dạngMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếChuong 2 nhận dạng rui roTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtMÔN TRUYỀN THÔNG MARKETING TÍCH HỢPQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ