Báo cáo y học: "Development and Validation of a HPV-32 Specific PCR Assay" pps

Báo cáo y học: "Development and Validation of a HPV-32 Specific PCR Assay" pps

Báo cáo y học: "Development and Validation of a HPV-32 Specific PCR Assay" pps

... Developed and ran the HPV-32 specific PCR assay, did all statistical analysis, and prepared the manu- script.NH: Extracted the clinical samples and tested them via the PGMY and HPV-32 dot blot assay. ... HPV-32 specific PCR assay has a sensitivity of 95.8% and 88.9% by sample and subject, respectively, and specificity was 87.8% and 58.8% by sample and subje...

Ngày tải lên: 12/08/2014, 04:21

7 424 0
Báo cáo y học: " Development and validation of a complementary map to enhance the existing 1998 to 2008 Abbreviated Injury Scale map" doc

Báo cáo y học: " Development and validation of a complementary map to enhance the existing 1998 to 2008 Abbreviated Injury Scale map" doc

... Palmer et al.: Development and validation of a complementary map to enhance the existing 1998 to 2008 Abbreviated Injury Scale map. Scandinavian Journal of Trauma, Resuscitation and Emergency ... of tra uma against current trau ma management standards requires that data be converted (’mapped’) to AIS08. The goal of mapping AIS98-coded data to AIS08 is to produce an accurate es...

Ngày tải lên: 13/08/2014, 23:20

13 688 0
Báo cáo y học: "Development and validation of the self-administered Fibromyalgia Assessment Status: a disease-specific composite measure for evaluating treatment effect" pptx

Báo cáo y học: "Development and validation of the self-administered Fibromyalgia Assessment Status: a disease-specific composite measure for evaluating treatment effect" pptx

... greater sensitivity but lower specificity, whereas a cut-off value of 4.6 gave a sensi- tivity of 58.7% with a specificity of 91.9%. Reliability analysis The reliability of the FAS index was evaluated ... non-ran- domised primary care sample. It can be assumed that the moti- vation of patients who volunteer to take part in a study is different from that of a random popul...

Ngày tải lên: 09/08/2014, 14:22

12 424 0
Báo cáo y học: "Development and validation of an ELISA using a protein encoded by ORF2 antigenic domain of porcine circovirus type 2" ppsx

Báo cáo y học: "Development and validation of an ELISA using a protein encoded by ORF2 antigenic domain of porcine circovirus type 2" ppsx

... a median value of 31.74%. These data showed that the assay was repeatable and yielded a low and acceptable variation. Evaluation of assay specificity and sensitivity The PCV2 GST-ORF2-E ELISA ... Laboratory of Veterinary Etiological Biology, Key Laboratory of Animal Virology of Ministry of Agriculture, Lanzhou Veterinary Research Institute, Chinese Academy of Agricultu...

Ngày tải lên: 12/08/2014, 01:22

7 420 0
Báo cáo y học: "Development and validation of molecular markers for characterization of Boehmeria nivea var. nivea and Boehmeria nivea var. tenacissima" pps

Báo cáo y học: "Development and validation of molecular markers for characterization of Boehmeria nivea var. nivea and Boehmeria nivea var. tenacissima" pps

... Sn-S62 -a CGACAGTAAACATAAAAACCG 1 1* Sn-S62-b CTGTTACCATTGGCTCTTTACC CAPS 60-67 CP-S62-f TCGTGCGGGTCATAGTACCCCGAGACAAGAGGCCAAAA 2 0.25, 0.3 (Afl III) CP-S62-r TGTAATACGAAAGTTTAAGTCTCTTTTCTTAGTC 0.2, ... CTCTTGAGCAATCCAAATGTTTTGTTATCA SR-S343-R1 CATAAATCACTTTATAACATAACGAGCTCGTATT 1 1.03 SR-S343-R2 CGCGACAGAGGGGTTTTCTTTCTATTA 1 0.95 SR-S343-R3 AGACGCCTCACTTTGATAGACATGAGTTTA 1 0.89 SNP 50-60 Sn...

Ngày tải lên: 13/08/2014, 14:20

9 352 0
báo cáo hóa học: " Development and validation of a preference based measure derived from the Cambridge Pulmonary Hypertension Outcome Review (CAMPHOR) for use in cost utility analyses" doc

báo cáo hóa học: " Development and validation of a preference based measure derived from the Cambridge Pulmonary Hypertension Outcome Review (CAMPHOR) for use in cost utility analyses" doc

... JR designed and managed the valuation survey, conducted analysis and reported on the valuation exercise. *DM ran the analysis to identify items for the valuation exercise, analysed the validation data and ... writ- ing of the manuscript. JB designed and managed the valu- ation survey, analysed and reported on the valuation data and contributed to the writing of the manuscrip...

Ngày tải lên: 18/06/2014, 19:20

8 591 0
báo cáo hóa học: " Development and validation of a French patient-based health-related quality of life instrument in kidney transplant: the ReTransQoL" pot

báo cáo hóa học: " Development and validation of a French patient-based health-related quality of life instrument in kidney transplant: the ReTransQoL" pot

... Fujisawa M, Ichikawa Y, Yoshiya K, Isotani S, Higuchi A, Nagano S, Arakawa S, Hamami G, Matsumoto O, Kamidono S: Assessment of health-related quality of life in renal transplant and hemodi- alysis ... Ortega F, Baltar JM, Díaz-Corte C, Navascués RA, Naves M, Ure a A, Bad a X, Alvarez-Ude F, Alvarez-Grande J: Health related quality of life (HRQOL) of kidney transplanted patients...

Ngày tải lên: 18/06/2014, 19:20

12 520 0
Báo cáo hóa học: " Development and validation of a Greek language version of the Manchester Foot Pain and Disability Index" docx

Báo cáo hóa học: " Development and validation of a Greek language version of the Manchester Foot Pain and Disability Index" docx

... citation purposes) Health and Quality of Life Outcomes Open Access Research Development and validation of a Greek language version of the Manchester Foot Pain and Disability Index Patricia Kaoulla 1 , ... in a pop- ulation-based survey of foot pain [13] as an outcome measure in a clinical trial [14] and as a measure of foot pain in people with Ehlers-Danlos syndro...

Ngày tải lên: 18/06/2014, 22:20

9 481 0
báo cáo hóa học:" Development and validation of a psychosocial screening instrument for cancer" potx

báo cáo hóa học:" Development and validation of a psychosocial screening instrument for cancer" potx

... Canada and 3 Health Care and Epidemiology, University of British Columbia, Canada Email: Wolfgang Linden* - wlinden@psych.ubc.ca; Dahyun Yi - dyi@hotmail.com; Maria Cristina Barroetavena - mbarroet@bccancer.bc.ca; ... evidence of validity. Finally, raw means and standard deviations are provided for each cancer type and each gender group (Table 4). This presentational approach app...

Ngày tải lên: 20/06/2014, 15:20

7 463 0
Báo cáo y học: " Development and evaluation of a tool for the assessment of footwear characteristics" pdf

Báo cáo y học: " Development and evaluation of a tool for the assessment of footwear characteristics" pdf

... range of each measure across included footwear was also reported. Intra-rater and inter-rater reliability for all cate- gorical data was evaluated using percentage agreement, and kappa (κ) statistics ... Inter-rater reliability for categorical measures. % agreement Kappa Variable Day 1 Day 2 Day 1 Day 2 Fit Adequate length (palpation) 88 83 0.59 0.66 Adequate length (straw method) 97 90...

Ngày tải lên: 10/08/2014, 21:23

12 379 0
w