Báo cáo y học: " Oral vaccination with a recombinant Salmonella vaccine vector provokes systemic HIV-1 subtype C Gag-specific " ppt

... that vaccination of mice orally with the Salmonella vaccine vector induced systemic Gag-spe- cific Th1 and Th2 cytokine responses. Oral vaccination of mice with recombinant Salmonella induces Gag-specific ... Elecsys ® HIV p24 Ag assay (Roche) according to manufacturer's recommendations. Salmonella vaccine stocks Stocks of recombinant Salmonella bacteria...

Ngày tải lên: 12/08/2014, 04:21

... Brunelli A, Xiume F, Al RM, Salati M, Marasco R, Sabbatini A: Air leaks after lobectomy increase the risk of empyema but not of cardiopulmonary complications: a case-matched analysis. Chest 2006, ... difficult to access by standard suturing or fleece-bond sealants, PleuraSeal™ as a liquid sealant is ideal to seal air leaks in this interlobar space with its many anatomical variations...

Ngày tải lên: 10/08/2014, 09:22

... caused by the amyloidosis. Introduction Reactive systemic AA amyloidosis, with a sustained acute phase response (APR), can complicate chronic inflamma- tory disorders. AA amyloid fibrils are derived ... approximately 45% of all cases of systemic amyloidosis, has been associ- ated with various chronic inflammatory conditions such * Correspondence: dtinanc@mynet.com 1 Zonguldak Karae...

Ngày tải lên: 11/08/2014, 12:20

... and pathogenicity Lesley J Mason 1 , Anastasia Lambrianides 2 , Joanna D Haley 2 , Jessica J Manson 1 , David S Latchman 2 , David A Isenberg 1 and Anisur Rahman 1 1 Centre for Rheumatology, ... possibility. Introduction Systemic lupus erythematosus (SLE) is an autoimmune rheu- matic disease of unknown aetiology, characterised by the presence of autoantibodies against a multiplicity o...

Ngày tải lên: 09/08/2014, 06:23

... signifi- cantly enhanced stimulatory capacity in mixed leukocyte culture and the ability to promote CD8 T cell expansion and cytolytic capacity. Therefore, this approach yields malignant cell loaded ... apoptotic cells found in co-cultures of a: CD8 T cells and DC loaded with apoptotic malignant T cells; b: CD8 T cells, DC and viable CTCL cells; c: DC loaded with apoptotic CTCL in the...

Ngày tải lên: 11/08/2014, 10:23

... The clinical course was characterized by an aggressive disease with significant extrarenal complica- tions. In Norway there are five University Hospitals with paediatric departments, all in close ... diarrhea- associated hemolytic uremic syndrome: a systematic review and meta- analysis. Diabetes Care 2005, 28:2556-2562. 21. Gallo EG, Gianantonio CA: Extrarenal involvement in diarrhoea-a...

Ngày tải lên: 13/08/2014, 23:20

... 5’-TTAAAAGAAAAGGGGGG-3’; pp57D, 5’-CGTTGGGAGTGAATTAGCCCTTCCA- GTCCCCCCTTTTCTTTTAAAAAGTGGCTAAGA-3’; kim40R, 5’-AAGCTTGGCTGCAGAATATTGCTAG- CGGGAATTCGGCGCG-3’; kim32D, 5’-CGCGCCGAATTCCCGCTAGCAATAT- TCTGCAG-3’; Tenofovir ... 3 ’- GACGTCTTATAACGATCGCCCTTAAGCCGCGC - 5 ’ -1 -10 -20 Kim40R 5’-AAGCUUGGCUGCAGAAUAUUGCUAGCGGGAAUUCGGCGCG-3’ Kim32D 3 ’- GACGTCTTATAACGATCGCCCTTAAGCCGCGC - 5 ’ RNase H activi...

Ngày tải lên: 13/08/2014, 01:20

... gel-based assays with HIV-1 PBS RNA template and tRNA3 Lys as primer. Single-cycle processivity was assayed under variable dNTP concentrations. Steady-state analysis was performed to measure ... activities are expressed as a percentage of subtype B wild-type RT specific activity. (C) Incorporation efficiency of TFV-DP by subtype C WT and mutant RTs was monitored by gel-based as...

Ngày tải lên: 13/08/2014, 05:21

... hematoma. Angiographic appearance of cavernous splenic hemangiomaFigure 2 Angiographic appearance of cavernous splenic hemangioma. 1. Splenic artery (black arrows). 2. Celiac trunk (white arrow). Journal ... with multiple hepatic hemangiomas. Pathogenetic mechanisms between hemangiomas and oral contraceptives, as well as therapeutic approaches, are analyzed in this case report, in parti...

Ngày tải lên: 11/08/2014, 23:21

... EGFP–N2-hspry4, composed of vector EGFP-N2 (Clontech, Palo Alto, CA, USA) and hspry4 cDNA, was constructed with primers: 5¢-TTA GGATCCATGCT CAGCCCCCTCCCC-3¢ forward and 5¢-G GAATTC TCCGAAAGGCTTGTCGG-3¢reverse, ... protein concentrations as determined by BCA assay (Bio-Rad). Yeast two-hybrid assay Full-length human sprouty 4 cDNA was amplified by PCR with forward primer 5¢-CTA GTCGACATGCT...

Ngày tải lên: 31/03/2014, 15:20