Báo cáo khoa học:" Evolution of the M gene of the influenza A virus in different host species: large-scale sequence analysis" pptx

... both avian lineages (Av1 and Av2) have been seen sporadically in humans, they have not been maintained in the population (blue characters in Av1 and Av2, Figure 1A and 1F). Strains with the M gene ... different hosts and host adaptation. Background The influenza virus is a common cause of respiratory infection all over the world. The influenza A virus ca...

Ngày tải lên: 12/08/2014, 04:21

... think of −w as the parameters of a process that “damage” the true model p ∗ , producing q 0 , and the estimation of w as learning to undo that damage. In the remainder of the paper, we use the ... 2; the different methods behave relatively similarly as the training data are reduced. Fig. 3 plots accuracy (on tuning data) against training time, for a vari- ety...

Ngày tải lên: 20/02/2014, 12:20

... show that NAC is unable to alter the course of a fatal influenza pneumonia caused by inoculation of a murinized swine H1N1 influenza virus. NAC was indeed able to inhibit the swine virus in vitro ... the analysis and interpretation of data, and drafted the manuscript. All authors read and approved the final manuscript. Competing interests The authors declare tha...

Ngày tải lên: 11/08/2014, 07:21

... envelope. The protein names deter- mined after sequence analyses of the cDNAs are indicated in parentheses. The numbers in parentheses at the end of each sequence indicate the position of the amino acid ... 4). The cDNAs were named based on sequence similarities of the ZP domains according to the nomen- clature of Spargo and Hope [10]. The amino acid s...

Ngày tải lên: 15/03/2014, 23:20

... is managed by ONF (Office National des Forêts). The site is at an altitude of 121 m, has a soil composed of loamy sand, an average annual temperature of 11 o C and an av- erage annual precipitation ... related mainly to their death rather than their development into epicormic shoots. Thus, this evolution of the epicormic potential has a favourable effect on the preparatio...

Ngày tải lên: 08/08/2014, 14:21

... verte- brate fossils appear some 2 to 4 million years early ». In research dealing with 131 species of Benthic Foraminifera on the Atlantic Continental Margin of North America, ... equator. HicxEY et al. (1983) found that new forms of animals and plants first appeared in the Arctic and migrated later to temperate climes. They report th...

Ngày tải lên: 09/08/2014, 22:22

... -430 TCAAAAGAGTAAACAAAAGAGGAAAAAGACTGAT TATTAATATAATAATAATATCCACAAAAATATTCGAATGCTTCAAGCCTAAGTTTGCT ppcA-Fbr -423 TCAAAAGAATAAAACATAGAGGAAAAAGACTGAT TATTAATTTAATAATAATATCCACAAAAATATTCCAATAATTCAACCCTGAGTTTGCT ppcA-Fpub ... TATTAATTTAATAATAATATCCACAAAAATATTCCAATAATTCAACCCTGAGTTTGCT ppcA-Fpub -435 TCAAAAGAGTAAAAAATAGAGGAAAAAGACTGAT TATTAATTTAATAATAATATCCACAAAAATATTCCAATAATTCAACCCTGAGTTTGCT ppcA-F...

Ngày tải lên: 12/08/2014, 05:20

... Fujisawa Y, Ikeda T, Nomoto K, Yasuda-Kamatani Y, Minakata H, Kenny PT, Kubota I & Muneoka Y (1992) The FMRFamide-related decapeptide of Mytilus contains a D-amino acid residue. Comp Biochem ... structures and the neuroendocrine complex (X organ–sinus gland). R, retina; LG, lamina ganglionaris; ME, medulla externa; MI, medulla interna; MT, medulla terminalis. (A) General view of...

Ngày tải lên: 18/02/2014, 11:20

... and quantification of all amines [indolyl-3-methanamine (3), N¢-methy- lindolyl-3-methanamine (7), tryptamine (9), 1-naph- thylmethanamine (18) and 2-naphthylmethanamine (20)]. HPLC analysis of ... these analyses indicated that brassinin was enzymatically transformed into 3-indolylmethanamine (3), carbonyl sulphide and methanethiol. The chemical mechanism of dithiocarbamate hydro- lysi...

Ngày tải lên: 18/02/2014, 14:20