Báo cáo khoa học:" The interaction between the measles virus nucleoprotein and the Interferon Regulator Factor 3 relies on a specific cellular environment" pdf

Báo cáo khoa học:" The interaction between the measles virus nucleoprotein and the Interferon Regulator Factor 3 relies on a specific cellular environment" pdf

Báo cáo khoa học:" The interaction between the measles virus nucleoprotein and the Interferon Regulator Factor 3 relies on a specific cellular environment" pdf

... citation purposes) Virology Journal Open Access Research The interaction between the measles virus nucleoprotein and the Interferon Regulator Factor 3 relies on a specific cellular environment Matteo ... using forward 5'-CATGAATTCATGGGAACCCCAAAGCCA -3& apos; and backward 5'-TGACTCGAGTCAGCTCTCCCCAG- GGCC -3& apos; primers containing EcoRI and...

Ngày tải lên: 12/08/2014, 04:21

17 308 0
Tài liệu Báo cáo khoa học: Functional interaction between RNA helicase II⁄Gua and ribosomal protein L4 pptx

Tài liệu Báo cáo khoa học: Functional interaction between RNA helicase II⁄Gua and ribosomal protein L4 pptx

... ATGGCCTCAGTTCCGAAAACCAACAAAATAGA Northern blot analysis probe, for 18S rRNA YH11 TTCTGACTTAGAGGCGTTCAGTCATAATCCCA Northern blot analysis probe, for 28S rRNA H. Yang et al. Gua–RPL4 interaction ... under Experimental procedures. H. Yang et al. Gua–RPL4 interaction in mammalian rRNA production FEBS Journal 272 (2005) 37 88 38 02 ª 2005 FEBS 37 95 33 Ueno M, Nakayama H, Kajikawa S, Kataya...

Ngày tải lên: 20/02/2014, 01:20

15 433 0
Tài liệu Báo cáo khoa học: Loose interaction between glyceraldehyde-3-phosphate dehydrogenase and phosphoglycerate kinase revealed by fluorescence resonance energy transfer–fluorescence lifetime imaging microscopy in living cells doc

Tài liệu Báo cáo khoa học: Loose interaction between glyceraldehyde-3-phosphate dehydrogenase and phosphoglycerate kinase revealed by fluorescence resonance energy transfer–fluorescence lifetime imaging microscopy in living cells doc

... phPGK1–5aa–cerulean were constructed using the primers 5¢-CCGGA ATTCC AATGT CGCTT TCTAA CAAGC T -3 and 5¢-GGCGG ATCCA TAATA TTGCT GAGAG CATCC A -3 , and 5¢- CCGGA ATTCC AATGT CGCTT TCTAA CAAGC T -3 and ... and 5¢-CGGAA TTCCG ATGGG GAAGG TGAAG GTCG G -3 , and 5¢-CGGAA TTCCG ATGGG GAAGG TGA AG GTCGG -3 and 5¢-CGACC GGTGT CTCCT TGG AG GCCAT GTGGG -3 , respectively, and pcitrine...

Ngày tải lên: 16/02/2014, 09:20

9 586 0
Báo cáo khoa học: "Ranking Algorithms for Named–Entity Extraction: Boosting and the Voted Perceptron" pdf

Báo cáo khoa học: "Ranking Algorithms for Named–Entity Extraction: Boosting and the Voted Perceptron" pdf

... the same as , but has an additional flag appended. The flag indi- cates whether or not the word appears in a dic- tionary of words which appeared more often lower-cased than capitalized in a large ... consecutive character types are not repeated in the mapped string. For example, An- imal would be mapped to Aa, G.M. would again be mapped to A. A The tagger was applied and train...

Ngày tải lên: 17/03/2014, 08:20

8 388 0
Báo cáo khoa học: "Discriminative Language Modeling with Conditional Random Fields and the Perceptron Algorithm" pptx

Báo cáo khoa học: "Discriminative Language Modeling with Conditional Random Fields and the Perceptron Algorithm" pptx

... y i . The features in the model are up- dated, and the algorithm moves to the next utterance. After each pass over the training data, performance on a held-out data set is evaluated, and the parameterization with ... discriminative language modeling for a large vocabulary speech recognition task. We con- trast two parameter estimation methods: the perceptron algorithm,...

Ngày tải lên: 23/03/2014, 19:20

8 459 0
Báo cáo khoa học: Direct interaction between CD91 and C1q docx

Báo cáo khoa học: Direct interaction between CD91 and C1q docx

... and C1q. The interaction was investigated using various protein interaction assays. A direct interaction between puri- fied C1q and CD91 was observed both by ELISA and a surface plasmon resonance ... a physiological salt concentration (0.15 m NaCl), the interaction was time-dependent, saturable and fast, being detectable after only a few minutes of incubation. By...

Ngày tải lên: 29/03/2014, 21:20

12 529 0
Báo cáo khoa học: "Preimplant factors affecting postimplant CTdetermined prostate volume and the CT/TRUS volume ratio after transperineal interstitial prostate brachytherapy with 125I free seeds" pps

Báo cáo khoa học: "Preimplant factors affecting postimplant CTdetermined prostate volume and the CT/TRUS volume ratio after transperineal interstitial prostate brachytherapy with 125I free seeds" pps

... performed the statistical analysis and drafted the manuscript, and oversaw the project completion. EK, HN, and HA participated in preparing of data acquisiti on. MO and NS contributed to data analysis. ... by a single radiation oncologist (AS). The plan- ning target volume included the prostate gland, with a margin of 3 mm anteriorly and laterally and 5 mm in the...

Ngày tải lên: 09/08/2014, 09:20

6 264 0
báo cáo khoa học: "Genetic relationship between prepuberal plasma FSH levels and reproductive performance in Lacaune ewe lambs" docx

báo cáo khoa học: "Genetic relationship between prepuberal plasma FSH levels and reproductive performance in Lacaune ewe lambs" docx

... variation caused by several factors in hormonal variables (FSH and its logarithm transformation) and in fertility and litter size. . - For FSH, the variance analysis was conducted ... correlation was observed beetwen plasma FSH concentration at 5 weeks of age and that observed at 3 and 7 weeks and, (2) at 5 weeks of age the highest...

Ngày tải lên: 09/08/2014, 22:22

9 258 0
w