Báo cáo khoa học:" A role for the JAK-STAT1 pathway in blocking replication of HSV-1 in dendritic cells and macrophages" docx

Tài liệu Báo cáo khoa học: A role for the intersubunit disulﬁdes of seminal RNase in the mechanism of its antitumor action docx

... SVT2 cells. The incubation was performed (A) in the absence of iodoacetamide (IAM), (B) in the presence of 10 mMIAM, or (C) of 50 mMIAM. D and M mark the elution volumes of BS-RNase and monomeric ... dimerization event occurs outside the cells, beforeinternalization, we investigated the role of plasma mem-branes (PM) in the transformation of MSSAE into a dimeric protein.125I-labelled MSSAE ... MSSAE was detached by high salt from SVT2 cells atincreasing time intervals. In the insert, autoradiographic scans of the SDS/PAGE runs. D and M mark the electrophoretic mobilities of BS-RNase...

Báo cáo khoa học:" A role for the JAK-STAT1 pathway in blocking replication of HSV-1 in dendritic cells and macrophages" docx

... infected APCs.Conclusion: These results suggest for the first time that the JAK-STAT1 pathway is involved in blocking replication of HSV-1 in DCs and macrophages.BackgroundsMacrophages and DCs are ... 5'-CAGTAGCGTGGGCATTT-TCTG-3'; reverse primer, 5'-CCTCGCCGGCAACAAAA-3'; and probe, 5'-FAM-CTCCAGGCGGACTTC-3' – Ampliconlength = 59 bp; and 4) gB: forward primer, 5'-AACGCGACGCACATCAAG-3', ... represents the mean ± SEM (n = 16). Panel B. DNA was isolated and the amount of viral genomic DNA was determined by Taq-Man PCR as described in Materials and Methods and normalized to GAPDH DNA. Each...

Báo cáo khoa học: " A role for the JAK-STAT1 pathway in blocking replication of HSV-1 in dendritic cells and macrophages" pps

... purposes) Replication of HSV-1 in macrophagesFigure 5 Replication of HSV-1 in macrophages. Analyses of virus replication, viral gB mRNA, and viral genomic DNA in macro-phages was done as in Fig. 2 for ... number not for citation purposes)Virology JournalOpen AccessResearch A role for the JAK-STAT1 pathway in blocking replication of HSV-1 in dendritic cells and macrophagesKevin R Mott1, David ... infected APCs.Conclusion: These results suggest for the first time that the JAK-STAT1 pathway is involved in blocking replication of HSV-1 in DCs and macrophages.BackgroundsMacrophages and DCs are...

Báo cáo khoa học: A role for serglycin proteoglycan in granular retention and processing of mast cell secretory granule components ppt

... early as after 5 days of culture, and a maximal plat-eau of storage was already seen at day 12. Both pro-CPA and mature CPA were detected in SG+ ⁄ + cells. A dramatically different pattern was ... detected at day0, the intracellular content of this enzyme increasedmarkedly after 6 days of culture, and reached a plat-eau from about day 12 (Fig. 2B). Both the kinetics of accumulation and the ... cellular viability (not shown).Degradation by the proteasome pathway could con-stitute an alternative degradative pathway in the absence of SG. However, incubation of cells with lac-tacystin, an...

Báo cáo khoa học: A strategy for the generation of speciﬁc human antibodies by directed evolution and phage display An example of a single-chain antibody fragment that neutralizes a major component of scorpion venom docx

... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGATGTTGTGATGACTCAGTCTCCVK3.link GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGTTGACGCAGTCTCCVK4.link GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCCVK5.link GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAACGACACTCACGCAGTCTCCVK6.link ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTAATTTTATGCTGACTCAGCCCCAJH1-2.link CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTGCCJH3.link CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAAGAGACGGTGACCATTGTCCCJH4-5.link CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTTCCJH6.link ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTCACGTTATACTGACTCAACCGCCVL5.link GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTCAGGCTGTGCTCACTCAGCCGTCVL6.link GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTAATTTTATGCTGACTCAGCCCCAJH1-2.link...

Báo cáo khoa học: "A Program for the Machine Translation of Natural Languages" pdf

... information-retaining cells. The information retained by any particular group of cells at any one time may be called the state of this part of the automaton. The state of the entire automa- ton ... what we have been calling a translation. The domain of this translation function is a certain class of texts in some language, and its range is a class of texts in another language. A text might ... following we give an account of a computer pro- gram for the translation of natural languages. The program has the following features: (1) it is adaptable to the translation of any two natural...

Báo cáo khoa học: "A TOOL FOR THE AUTOMATIC CREATION, EXTENSION OF LEXICAL KNOWLEDGE" pdf

... contain pointers to the different forms belonging to their para- digm, and information relevant to all forms of a para- digm: e.g. case frames and semantic information). The corresponding ... responsible for computing the regular paradigm, which analyses this information and transfers control to an object computing forms of verbs belonging to a particular category of irregular verbs. Again ... compute the inflected forms of this verb, the phonetic transcription, syllable and morphologi- cal boundaries of the citation form and the inflected forms, and of the forms derived from these inflected...

Báo cáo khoa học: "A Language for the Statement of Binary Relations over Feature Structures" ppt

... and the range by those labelled 'L2', or vice versa. One may then think of compiled transfer rules as having a 'left-hand' or 'input' and a 'right-hand' ... its interpretation, outline two alternative rule application regimes, and illus- trate the use of the formalism in the areas of machine translation and reduction of FSs to canonical form. ... synthesis of another; they may be thought of as a specialized variety of pattern- matching rule. They are local in nature, and permit the recursive analysis and synthesis of complex structures according...

báo cáo khoa học: " A role for neurotransmission and neurodevelopment in attention‑deficit/hyperactivity disorder" ppsx

... (SNPs) investigated in these six genes, an association with BAIAP2 was detected, by both the single- and multiple-marker analyses, in the adult ADHD Spanish sample. In the replication study, the ... (DAT1) in ADHD families. Using the family-based approach called ‘haplotype relative risk’, an association with the ten-repeat allele was detected. In the following year, LaHoste et al. [7] investigated ... in cases of persistent ADHD.BAIAP2 is located at 17q25 and encodes the 53 kDa insulin receptor tyrosine kinase substrate protein (IRSp53), a molecule that participates in the signal transduction...

Báo cáo y học: "A role for the histone deacetylase HDAC4 in the life-cycle of HIV-1-based vectors" ppsx

... 5′-CCTGCGTCGAGA GAGCTC-3′. To quantitate the viralamplicon, a TaqMan dual 5′-6-carboxyfluorescein -and 3′-6-carboxytetramethylrhodamimine-labeled probe wasused: 5′ -(FAM)-CAGTGGCGCCCGAACAGGGA-(TAMRA)-3′ ... integrase-mediatedjoining occurred, and thus again manifests as a decrease in the Alu-PCR signal [25,26].HDAC4 is involved in PIR in ATM-deficient cells HDAC4 is a DSB rep air prote in, and it had ... 4 Effect of an integrase inhibitor on the formation of HDAC4 foci in infected cells. HeLa cells we re infected with the HIV-1-basedvector in the presence and absence of the integrase inhibitor...

Xem thêm