Báo cáo khoa học:" In vitro host range, multiplication and virion forms of recombinant viruses obtained from co-infection in vitro with a vaccinia-vectored influenza vaccine and a naturally occurring cowpox virus isolate" pot
Báo cáo khoa học:" In vitro host range, multiplication and virion forms of recombinant viruses obtained from co-infection in vitro with a vaccinia-vectored influenza vaccine and a naturally occurring cowpox virus isolate" pot
... multiplication and virion forms of recombinant viruses obtained from co-infection in vitro with a vaccinia-vectored influenza vaccine and a naturally occurring cowpox virus isolate Malachy Ifeanyi ... Traavik T: Recombinant viruses obtained from co-infection in vitro with a live vaccinia-vec- tored influenza vaccine and a...
Ngày tải lên: 12/08/2014, 04:21
Báo cáo khoa học: " In vitro host range, multiplication and virion forms of recombinant viruses obtained from co-infection in vitro with a vaccinia-vectored influenza vaccine and a naturally occurring cowpox virus isolate" pps
... Traavik T: Recombinant viruses obtained from co-infection in vitro with a live vaccinia-vec- tored influenza vaccine and a naturally occurring cowpox virus display different plaque phenotypes and ... confirmed that co-infecting in vitro a Modified vaccinia virus Ankara (MVA) strain engineered to express influenza virus haemagglutinin (HA) and...
Ngày tải lên: 12/08/2014, 04:21
Báo cáo khoa học: " Risk factors for retained placenta and the effect of retained placenta on the occurrence of postpartum diseases and subsequent reproductive performance in dairy cows" potx
... describe calving condition, parity, gestation length, and calving season. In order to evaluate the influence on development of retained placenta of abnormal partus (total cases of dystocia, caesarean ... diagnosed by clinical signs observed by the veterinarian and/ or farmer within 4 weeks postpartum. Abomasal displacement was diagnosed by a pinging sound upon abdominal auscultat...
Ngày tải lên: 07/08/2014, 18:21
Báo cáo khoa học: "Glutamine induces heat-shock protein and protects against Escherichia coli lipopolysaccharide-induced vascular hyporeactivity in rats" pdf
... catecho- lamine vasoconstrictors and that the effect of Ala-Gln is asso- ciated with its capacity to induce HSP70 expression and attenuate release of pro-inflammatory cytokines and oxidizing species ... pathophysiological state, and despite considerable therapeutic advances, it remains a major therapeutic challenge with a high incidence of mortality [1]. Vascular hyporea...
Ngày tải lên: 13/08/2014, 03:20
Tài liệu Báo cáo khoa học: Competition between innate multidrug resistance and intracellular binding of rhodamine dyes pdf
... subline was obtained by sequential exposure of cells to increasing concentrations of doxorubicin and was maintained in the presence of 0.5 lm doxorubicin. A total of 2008 parental cells and their ... that MRP1 interferes with the accu- mulation of rhodamines and drugs participating in the MDR phenomenon inside a wide variety of healthy and malignant cells. Pres...
Ngày tải lên: 18/02/2014, 13:20
Báo cáo khoa học: Human telomeric G-quadruplex: thermodynamic and kinetic studies of telomeric quadruplex stability potx
... quadruplex folding and unfolding reac- tions, with the significant advantage that enthalpy changes can be monitored directly and data obtained in a model-free fashion [36,37]. Disadvantages of ... spectra as a function of temperature, instead of single wavelength data. A set of spectra as a function of temperature defines a 3D surface that is easily converted to a...
Ngày tải lên: 06/03/2014, 09:22
Báo cáo khoa học: Amino acids at the N- and C-termini of human glutamate carboxypeptidase II are required for enzymatic activity and proper folding pptx
... AAACTCGAGAGATCTAAATCCTCCAATGAAGC 30 s/94 °C; 1 min/56 °C; 4 min/72 °C AAACTCGAGTTATTATTCAATATCAAACAGAG 59/750 AAAAGATCTAAAGCATTTTTGGATGAATTG 1 min/94 °C; 1 min/54 °C; 4 min/72 °C ATTCTCGAGTCATTAGGCTACTTCACTCAAAG 90/750 ... min/57 °C; 4 min/72 °C ATTCTCGAGTCATTAGGCTACTTCACTCAAAG 274/587 AAACTCGAGAGATCTAAATCCTCCAATGAAGC 30 s/94 °C; 1 min/56 °C; 3 min/72 °C CACCTCGAGTTATTATAGCTCAAACACCATCC 44/58...
Ngày tải lên: 07/03/2014, 15:20
Báo cáo khoa học: Residues affecting the chloride regulation and substrate selectivity of the angiotensin-converting enzymes (ACE and ACE2) identified by site-directed mutagenesis pot
... result of an alteration in substrate-binding affinity but of an increase in V max . The R514Q ACE2 variant or variants with enhanced activity towards angiotensin II have potential therapeutic value in ... bars) NaCl. (A) Cleavage of angiotensin I by tACE variants. (B) Cleavage of angiotensin I by ACE2 variants. (C) Cleavage of angio- tensin II by ACE2 variants. Generation of...
Ngày tải lên: 16/03/2014, 04:20
Báo cáo khoa học: Purification, characterization, cDNA cloning and nucleotide sequencing of a cellulase from the yellow-spotted longicorn beetle, Psacothea hilaris ppt
... reducing agent and incubated at 33 °Cfor 30mintoloadanSDS/polyacrylamidegel.TheSDS/ PAGE analysis detected three proteins bands by CBB staining and one activity band by activity staining. Proteins including ... SDS/PAGE. N-Terminal amino-acid sequencing analysis indicated that thematureproteinofP. hilaris cellulase was a truncated form, which lacked a signal peptide composed of the...
Ngày tải lên: 17/03/2014, 10:20
Báo cáo khoa học: Structural insight into the evolutionary and pharmacologic homology of glutamate carboxypeptidases II and III ppt
... ‘pseudo-unliganded’ complex only), as having either favorable or allowed conforma- tions. Despite falling into the disallowed region of the Ramachandran plot, all atoms of Lys197 and Asn168 have a well ... (amino acids 46–106 and 342–580), an apical domain (amino acids 107–341) and a helical domain (amino acids 581– 740). The overall structures of both proteins are quite simil...
Ngày tải lên: 23/03/2014, 05:22