Báo cáo khoa học: " Characterization of a VHS virus genotype III isolated from rainbow trout (Oncorhychus mykiss) at a marine site on the west coast of Norway" doc

Báo cáo khoa học: " Characterization of a VHS virus genotype III isolated from rainbow trout (Oncorhychus mykiss) at a marine site on the west coast of Norway" doc

Báo cáo khoa học: " Characterization of a VHS virus genotype III isolated from rainbow trout (Oncorhychus mykiss) at a marine site on the west coast of Norway" doc

... Access Characterization of a VHS virus genotype III isolated from rainbow trout (Oncorhychus mykiss) at a marine site on the west coast of Norway Henrik Duesund, Stian Nylund, Kuninori Watanabe, ... CCC ATG AGC CGC TCT CTC T Elongation factor EL 1A- elaf CCC CTC CAG GAC GTT TAC AAA 1 alpha EL 1A- elam1 ATC GGT GGT ATT GGA AC 57 nt [45] S. salar EL...

Ngày tải lên: 12/08/2014, 04:21

15 252 0
Báo cáo khoa học: Characterization of native and recombinant A4 glyceraldehyde 3-phosphate dehydrogenase Kinetic evidence for conformation changes upon association with the small protein CP12 pptx

Báo cáo khoa học: Characterization of native and recombinant A4 glyceraldehyde 3-phosphate dehydrogenase Kinetic evidence for conformation changes upon association with the small protein CP12 pptx

... concentration was kept at 850 l M andtheNAD(P)Hconcentrationvariedfrom 0to300l M (Fig. 3A, B). The data were fitted to a hyperbola (Eqn 3) to estimate the catalytic constant (k cat ) and K m . m ½E 0 ¼ ... 14 h at 4 °C, kinetic experiments showed that the k cat of the reconstituted complex was still equal to the k cat of native GAPDH and the K 0.5 for BPGA also became eq...

Ngày tải lên: 23/03/2014, 20:22

8 335 0
Báo cáo khoa học: Characterization of L-aspartate oxidase and quinolinate synthase from Bacillus subtilis potx

Báo cáo khoa học: Characterization of L-aspartate oxidase and quinolinate synthase from Bacillus subtilis potx

... the oxidation of l-aspartate to iminoaspartate; the second enzyme, quinolinate syn- thase (NadA), is encoded by the gene nadA and cata- lyzes the condensation between iminoaspartate and DHAP, resulting ... of iminoaspartate. The iminoaspartate itself was stabilized upon binding to NadB, as the observed rate constant of hydrolysis of free iminoaspartate to oxaloacetate and...

Ngày tải lên: 30/03/2014, 02:20

18 350 0
Tài liệu Báo cáo khoa học: Characterization of the interaction between the plasma membrane H+-ATPase of Arabidopsis thaliana and a novel interactor (PPI1) doc

Tài liệu Báo cáo khoa học: Characterization of the interaction between the plasma membrane H+-ATPase of Arabidopsis thaliana and a novel interactor (PPI1) doc

... from clones isolated previously [22] using the following primers: gatggatcccatATGGGTG TTGAAGTTGTA annealing around the start codon of the Ppi1 ORF and gactcgagATTAGTCGACTTCTTACGC annealing just ... dependence of PPI1- induced activation of the H + -ATPase showed that stimulation decreases dramatically with the increase of pH above pH 6.8; PPI1-induced activation of th...

Ngày tải lên: 19/02/2014, 07:20

8 629 0
Tài liệu Báo cáo khoa học: Characterization of a recombinantly expressed proteinase K-like enzyme from a psychrotrophic Serratia sp. ppt

Tài liệu Báo cáo khoa học: Characterization of a recombinantly expressed proteinase K-like enzyme from a psychrotrophic Serratia sp. ppt

... 5¢-GA AAAACCATGGTGAATGAATACCAAGCGACT-3¢ ) and downstream primer (NP7: 5¢-CAATCTCCATGGCTAG TAGCTTGCACTCAG-3¢) containing a NcoI restriction site and 1 U of Pfu-polymerase. PCR amplification was carried out at ... the enzymatic activities originating from these strains (unpublished data). One of the marine bacteria showing peptidase activ- ity was closely related to Serratia pr...

Ngày tải lên: 19/02/2014, 07:20

14 524 0
Tài liệu Báo cáo khoa học: Characterization of promoter 3 of the human thromboxane A2 receptor gene A functional AP-1 and octamer motif are required for basal promoter activity docx

Tài liệu Báo cáo khoa học: Characterization of promoter 3 of the human thromboxane A2 receptor gene A functional AP-1 and octamer motif are required for basal promoter activity docx

... sequence aaA TGCa to aaTTCCa (core bases shown in uppercase letters) centered at )123 within Prm3 was performed using the mutator primers Kin175 (5¢-CACCAGAGCTACTTACA CTGAATTCCAGAATAATCACAAGCAAATC-3¢; ... 5¢-dGAGA GGTACCGAATTAATCACAAGCAA ATCTTCTC-3¢, corresponding to NTs )119 to )94). (7) Prm3aab; pGL3b:Prm3aab & pGL3e:Prm3aab. (Primer Kin160; 5¢-dGAGA GGTACCGCAAATCTTCTCTCGCC TCC-3¢,...

Ngày tải lên: 19/02/2014, 16:20

18 509 0
Tài liệu Báo cáo khoa học: Characterization of a chemosensory protein (ASP3c) from honeybee (Apis mellifera L.) as a brood pheromone carrier pdf

Tài liệu Báo cáo khoa học: Characterization of a chemosensory protein (ASP3c) from honeybee (Apis mellifera L.) as a brood pheromone carrier pdf

... M. brassicae CSPMbraA6 [32]. We observed also that BrC15-Ac was able to displace ASA, suggesting that brominated fatty acid and ASA both associated with W81 in the same ligand binding site. The ... revealed that ASP3c mainly consists of a- helices, like other insect CSPs. Gel filtration analysis showed that ASP3c is monomeric at neutral pH. Using ASA, a fluorescent fatty acid anthro...

Ngày tải lên: 21/02/2014, 03:20

11 642 0
Báo cáo khoa học: Characterization of a thiamin diphosphate-dependent phenylpyruvate decarboxylase from Saccharomyces cerevisiae potx

Báo cáo khoa học: Characterization of a thiamin diphosphate-dependent phenylpyruvate decarboxylase from Saccharomyces cerevisiae potx

... alternative pathways are avail- able, it is unlikely to play any significant role in the catabolism of the branched-chain amino acids or of methionine. Identification and mutation of residues affecting substrate ... the Bradford assay using BSA as standard. Assay The decarboxylation activity of ScPPDC-His on a range of aromatic and aliphatic 2-keto acids was monitored at...

Ngày tải lên: 06/03/2014, 00:21

12 436 0
Báo cáo khoa học: Characterization of the rice carotenoid cleavage dioxygenase 1 reveals a novel route for geranial biosynthesis ppt

Báo cáo khoa học: Characterization of the rice carotenoid cleavage dioxygenase 1 reveals a novel route for geranial biosynthesis ppt

... a- tocopherole acetate (1 mgÆmL )1 ) was added as internal standard to each assay prior to extraction. The conversion rates were determined by calculating the decrease of substrate peak areas measured at their ... an explanation for the impact of lycopene accumulation on the emission of geranial, as observed in the fruits of several tomato and watermelon varieties [46],...

Ngày tải lên: 07/03/2014, 03:20

12 498 0
Báo cáo khoa học: Characterization of inhibitors of phosphodiesterase 1C on a human cellular system potx

Báo cáo khoa học: Characterization of inhibitors of phosphodiesterase 1C on a human cellular system potx

... GAT CATGCACTGAAATTTA (2), GATGAAACCTCTCAA ACTG (3), and CATCATCGCTGGACAATGT (4)], using T. R. Dunkern and A. Hatzelmann Characterization of inhibitors of PDE1C FEBS Journal 274 (2007) 4812–4824 ª 2007 The ... ionomycin at these higher concentra- tions. The addition of 50 mm EGTA (as a control) at the end of the experiment (indicated by a solid arrow in Fig. 4A) decr...

Ngày tải lên: 07/03/2014, 05:20

13 462 0
Từ khóa:
w