Báo cáo y học: "Evidence that Gag facilitates HIV-1 envelope association both in GPI-enriched plasma membrane and detergent resistant membranes and facilitates envelope incorporation onto virions in primary CD4+ T cells" doc

Báo cáo y học: "Evidence that Gag facilitates HIV-1 envelope association both in GPI-enriched plasma membrane and detergent resistant membranes and facilitates envelope incorporation onto virions in primary CD4+ T cells" doc

Báo cáo y học: "Evidence that Gag facilitates HIV-1 envelope association both in GPI-enriched plasma membrane and detergent resistant membranes and facilitates envelope incorporation onto virions in primary CD4+ T cells" doc

... facilitates HIV-1 envelope association both in GPI-enriched plasma membrane and detergent resistant membranes and facilitates envelope incorporation onto virions in primary CD4 + T cells Ajit Patil † , ... proteins in primary CD4 + T cells that are natural targets of HIV-1 is poorly understood. Here we show that in primary CD4 + T...

Ngày tải lên: 12/08/2014, 04:21

5 259 0
Tài liệu Báo cáo Y học: Evidence that a eukaryotic-type serine/threonine protein kinase from Mycobacterium tuberculosis regulates morphological changes associated with cell division docx

Tài liệu Báo cáo Y học: Evidence that a eukaryotic-type serine/threonine protein kinase from Mycobacterium tuberculosis regulates morphological changes associated with cell division docx

... with that of functionally characterized prokaryotic serine/threonine kinases indicated its possible involvement in cell d ivision/differentiation. Protein–protein interaction studies revealed that ... important insights into their contributions to signal transduction. This may help in the design o f drug intervention strategies in a s ituation where the emergence of drug -resistant...

Ngày tải lên: 22/02/2014, 04:20

8 428 0
Báo cáo y học: "Evidence that CFTR is expressed in rat tracheal smooth muscle cells and contributes to bronchodilation" pptx

Báo cáo y học: "Evidence that CFTR is expressed in rat tracheal smooth muscle cells and contributes to bronchodilation" pptx

... demonstrated that the relaxation to substance P and ATP persisted in the tra- cheas from Cftr -/- mice, and that the magnitude of the relaxation was not significantly different from that in the wild-type ... activity is identical to that of the epithelial CFTR suggesting that CFTR is the major pathway for cAMP-regulated chloride transport in TSMC, (iv) finally, using isom...

Ngày tải lên: 12/08/2014, 16:20

10 315 0
Báo cáo Y học: Effect of the disease-causing mutations identified in human ribonuclease (RNase) H2 on the activities and stabilities of yeast RNase H2 and archaeal RNase HII pot

Báo cáo Y học: Effect of the disease-causing mutations identified in human ribonuclease (RNase) H2 on the activities and stabilities of yeast RNase H2 and archaeal RNase HII pot

... 5¢-GGGG AAGCTTCTA GTGGTGGTGGTGGTGGTGCTTACGTTTAAAAAAT CCATC-3¢ for RNH2B-R; 5¢-ATAT AAGCTTCTCTCAA GGAGATATACTTATGACCAAAGATGCCGTG-3¢ for RNH2C-F; and 5¢-GGAG CTCGAGTTAGTGGTGGTG GTGGTGGTGCTGATTTATGACATCGATGAGG-3¢ ... primers are: 5¢-ATTAT CATATGGGTACCCCCACGG-3¢ for RNH2A-F; 5¢-TG TG GAATTCAGTGGTGGTGGTGGTGGTGCCGGTAC CAATTATCTAGGG-3¢ for RNH2A-R; 5¢-ATAT GAA TTCTCTCTAAGGAGATATACTTAT GACCGTTTC CA...

Ngày tải lên: 17/03/2014, 17:20

14 483 0
Báo cáo y học: "Successful surgical resection of infected left atrial myxoma in a case complicated with disseminated intravascular coagulation and multiple cerebral infarctions: case report" ppt

Báo cáo y học: "Successful surgical resection of infected left atrial myxoma in a case complicated with disseminated intravascular coagulation and multiple cerebral infarctions: case report" ppt

... attached the septal wall (allow) with the red thrombus and vegetation (*). (B): Hematoxylin and eosin (HE) and showed that the mass was an atrial myxoma, and gram staining of the infected portion ... ampicillin, his general condition was getting better and was extubated at the second postoperative day. The antibiotic therapy with ampicillin was totally administered for six weeks....

Ngày tải lên: 10/08/2014, 09:21

4 543 0
Báo cáo y học: "Functional diversity of HIV-1 envelope proteins expressed by contemporaneous plasma viruses" potx

Báo cáo y học: "Functional diversity of HIV-1 envelope proteins expressed by contemporaneous plasma viruses" potx

... infectivity and sensitivity to entry inhibitors, indicating that these properties are, to some extent, dissociable. These findings demonstrate the marked functional heterogeneity of HIV-1 Env proteins expressed ... sensitivity comparing Env clones isolated from different patients [58]. These findings suggest that genetic determinants important in defining the sensitivity to these en...

Ngày tải lên: 13/08/2014, 06:20

16 184 0
Báo cáo y học: "Comparison of the oxidative phosphorylation (OXPHOS) nuclear genes in the genomes of Drosophila melanogaster, Drosophila pseudoobscura and Anopheles gambiae" docx

Báo cáo y học: "Comparison of the oxidative phosphorylation (OXPHOS) nuclear genes in the genomes of Drosophila melanogaster, Drosophila pseudoobscura and Anopheles gambiae" docx

... cytochrome c). Interestingly, although Cyt- c-d is adjacent to its putative parent gene, Cyt-c-p, it shows a different pattern of expression, suggesting that the two genes must be regulated at individual ... suggesting that they share aspects of transcriptional regulation depending on their inclusion in the same chromatin domain. In particular, Boutanaev et al. [48] reported that i...

Ngày tải lên: 14/08/2014, 14:21

17 292 0
Báo cáo y học: "Evidence of functional selection pressure for alternative splicing events that accelerate evolution of protein subsequences" pps

Báo cáo y học: "Evidence of functional selection pressure for alternative splicing events that accelerate evolution of protein subsequences" pps

... but intriguingly that this effect is accompanied by a strong increase in selection pressure against synonymous mutations, which propagates into the adjacent intron, and correlates strongly with ... protein reading frame preservation (35); and silent nucleotide substitutions (this study). Indeed, the observation that alternative 19 splicing and splice-regulatory motifs are associat...

Ngày tải lên: 14/08/2014, 14:21

30 131 0
Báo cáo y học: "Evidence-Based Dentistry: What’s New"

Báo cáo y học: "Evidence-Based Dentistry: What’s New"

... sufficient detail to permit replication?; are the results likely to be valid?; what are the results of the study, and will they help provide better patient treatment?; were both statistical and clinical ... dentistry is the use of current best evidence in making decisions about the care of individual patients. Carrying out evidence-based dentistry requires that the practitione...

Ngày tải lên: 26/10/2012, 09:57

5 541 0
Tài liệu Báo cáo khoa học: Evidence that the assembly of the yeast cytochrome bc1 complex involves the formation of a large core structure in the inner mitochondrial membrane pdf

Tài liệu Báo cáo khoa học: Evidence that the assembly of the yeast cytochrome bc1 complex involves the formation of a large core structure in the inner mitochondrial membrane pdf

... stability. It is therefore tempting to speculate that the larger bc 1 core structure acquires a higher stability against proteolytic degrada- tion after incorporation of the two core proteins. The ... stability, strongly argues against the possibility that it may represent a degradation product or an incorrect assembly intermediate found only in a single mutant strain. Previous studie...

Ngày tải lên: 18/02/2014, 08:20

15 640 0
Từ khóa:
w