Báo cáo khoa học: " Modeling gene sequences over time in 2009 H1N1 Influenza A Virus populations" pps
Báo cáo khoa học: " Modeling gene sequences over time in 2009 H1N1 Influenza A Virus populations" pps
... Influenza A Virus
populations
Natalia Goñi, Alvaro Fajardo, Gonzalo Moratorio, Rodney Colina and
Juan Cristina*
Address: Laboratorio de Virolog a Molecular, Centro de Investigaciones Nucleares, ...
2009 H1N1 emerging strains
In order to gain insight into the evolutionary rate and
mode of evolution of 2009 H1N1 IAV strains, we used a
Bayesian Markov Chain Montecarlo (MCMC)...
Báo cáo y học: "Clinical aspects and cytokine response in severe H1N1 influenza A virus infection" pot
... of ala-
nine aminotransferase, aspartate aminotransferase, lac-
tate dehydrogenase and creatinine - as in other patient
groups with novel influenza virus infection [4,6]. In con-
trast, the bacterial-ARDS ... of cytokines when
comparing viral ARDS with bacterial ARDS.
Introduction
Originating f rom Mexico and spreading initially in the
United States and Canada, a novel influenza...
Báo cáo khoa học: "Modeling Commonality among Related Classes in Relation Extraction" doc
... since, in this
case, a classifier learning approach can always
learn a nearly optimal discriminative function for
each class against the remaining classes. How-
ever, such flat strategy may cause ... amounts of annotated examples.
3 Hierarchical Learning Strategy
Traditional classifier learning approaches apply
the flat learning strategy. That is, they equally
treat training exam...
Báo cáo khoa học: Modeling hydration mechanisms of enzymes in nonpolar and polar organic solvents potx
... a rapid increase in bound water, followed
by a second step in which there is a slow increase, and
then a third step of high water activity, where again
there is a sharp increase. The water range ... Carlsberg formed in anhydrous
acetonitrile and in water. Proc Natl Acad Sci USA 95,
12918–12923.
33 Yennawar NH, Yennawar HP & Farber GK (1994)
X-ray crystal-structure of gam...
Báo cáo khoa học: "Modeling Norms of Turn-Taking in Multi-Party Conversation" ppt
... speech
activity, such as that implementing backchannels.
Since backchannels are often produced in overlap
1006
2 Data
Analysis and experiments are performed using the
ICSI Meeting Corpus (Janin et al., ... Sequence Organization
in Interaction. Cambridge University Press, Cam-
bridge, UK.
Mark Seligman, Junko Hosaka, and Harald Singer.
1997. “Pause units” and analysis of spontaneous
Japane...
Báo cáo khoa học:" The directionality of the nuclear transport of the influenza A genome is driven by selective exposure of nuclear localization sequences on nucleoprotein" pptx
... immunolabeling with
the anti-NLS antibodies and a monoclonal antibody
against the nucleolar protein fibrillarin. As illustrated in
Fig. 7a, we found that in influenza- infected cells, NLS1
was not ... 1Z4, Canada
Email: Winco WH Wu - winco@zoology.ubc.ca; Nelly Panté* - pante@zoology.ubc.ca
* Corresponding author
Abstract
Background: Early in infection, the genome of the influenza...
Báo cáo khoa học: Enhancing the protein production levels in Escherichia coli with a strong promoter potx
... promoters lacUV5 and trc
were amplified by PCR from vectors including the relevant
genes. By using primers TEHA1: ACACAGATCTCTGCA-
GGGCACCCCAGGCTTTACA and TEHA2: ACACCC-
ATGGAGCTTTCCTGTGTGAAATTGT, lacUV5 ... GGGATGTTGAAACGCTT
GTTG and GFP6_R: CGGTCACGAACTCCAGCAG,
respectively. The input of total RNA was 2 lg. A mixture
containing total RNA, dNTPs (Invitrogen, Carlsbad, CA,
USA) and 5 pmol of...
Báo cáo khoa học: Kinetic analysis of zymogen autoactivation in the presence of a reversible inhibitor pptx
... progress can be
determined. In a ddition, some zymogen preparations may
contain more than 5% of a ctive contaminating enzyme. In
these cases, the initial-rate assumption becomes impractical,
and alternative ... autocatalytic activation of
zymogens plays a key role in the regulation of many
integrated metabolic systems in living organisms, a detailed
kinetic analysis for the au...
Báo cáo khoa học: "Prediction and prevention of suicide in patients with unipolar depression and anxiety" ppsx
... data available concerning the prevalence,
method and lethality of suicide in relationship to different
healthcare settings the patients had sought help from.
Data so far indicate that most variation ... [6-8,75].
In general, it seems that the same factors and characteris-
tics that determine suicidal behaviour in major depressive
patients as well as treatment strategies apply for those...
Từ khóa: