Báo cáo khoa học: " Modeling gene sequences over time in 2009 H1N1 Influenza A Virus populations" pps
... Influenza A Virus populations Natalia Goñi, Alvaro Fajardo, Gonzalo Moratorio, Rodney Colina and Juan Cristina* Address: Laboratorio de Virolog a Molecular, Centro de Investigaciones Nucleares, ... 2009 H1N1 emerging strains In order to gain insight into the evolutionary rate and mode of evolution of 2009 H1N1 IAV strains, we used a Bayesian Markov Chain Montecarlo (MCMC)...
Ngày tải lên: 12/08/2014, 04:21
... of ala- nine aminotransferase, aspartate aminotransferase, lac- tate dehydrogenase and creatinine - as in other patient groups with novel influenza virus infection [4,6]. In con- trast, the bacterial-ARDS ... of cytokines when comparing viral ARDS with bacterial ARDS. Introduction Originating f rom Mexico and spreading initially in the United States and Canada, a novel influenza...
Ngày tải lên: 13/08/2014, 21:21
... since, in this case, a classifier learning approach can always learn a nearly optimal discriminative function for each class against the remaining classes. How- ever, such flat strategy may cause ... amounts of annotated examples. 3 Hierarchical Learning Strategy Traditional classifier learning approaches apply the flat learning strategy. That is, they equally treat training exam...
Ngày tải lên: 08/03/2014, 02:21
Báo cáo khoa học: Modeling hydration mechanisms of enzymes in nonpolar and polar organic solvents potx
... a rapid increase in bound water, followed by a second step in which there is a slow increase, and then a third step of high water activity, where again there is a sharp increase. The water range ... Carlsberg formed in anhydrous acetonitrile and in water. Proc Natl Acad Sci USA 95, 12918–12923. 33 Yennawar NH, Yennawar HP & Farber GK (1994) X-ray crystal-structure of gam...
Ngày tải lên: 16/03/2014, 10:20
Báo cáo khoa học: "Modeling Norms of Turn-Taking in Multi-Party Conversation" ppt
... speech activity, such as that implementing backchannels. Since backchannels are often produced in overlap 1006 2 Data Analysis and experiments are performed using the ICSI Meeting Corpus (Janin et al., ... Sequence Organization in Interaction. Cambridge University Press, Cam- bridge, UK. Mark Seligman, Junko Hosaka, and Harald Singer. 1997. “Pause units” and analysis of spontaneous Japane...
Ngày tải lên: 17/03/2014, 00:20
Báo cáo khoa học:" The directionality of the nuclear transport of the influenza A genome is driven by selective exposure of nuclear localization sequences on nucleoprotein" pptx
... immunolabeling with the anti-NLS antibodies and a monoclonal antibody against the nucleolar protein fibrillarin. As illustrated in Fig. 7a, we found that in influenza- infected cells, NLS1 was not ... 1Z4, Canada Email: Winco WH Wu - winco@zoology.ubc.ca; Nelly Panté* - pante@zoology.ubc.ca * Corresponding author Abstract Background: Early in infection, the genome of the influenza...
Ngày tải lên: 12/08/2014, 04:21
Báo cáo khoa học: Enhancing the protein production levels in Escherichia coli with a strong promoter potx
... promoters lacUV5 and trc were amplified by PCR from vectors including the relevant genes. By using primers TEHA1: ACACAGATCTCTGCA- GGGCACCCCAGGCTTTACA and TEHA2: ACACCC- ATGGAGCTTTCCTGTGTGAAATTGT, lacUV5 ... GGGATGTTGAAACGCTT GTTG and GFP6_R: CGGTCACGAACTCCAGCAG, respectively. The input of total RNA was 2 lg. A mixture containing total RNA, dNTPs (Invitrogen, Carlsbad, CA, USA) and 5 pmol of...
Ngày tải lên: 06/03/2014, 01:20
Báo cáo khoa học: Kinetic analysis of zymogen autoactivation in the presence of a reversible inhibitor pptx
... progress can be determined. In a ddition, some zymogen preparations may contain more than 5% of a ctive contaminating enzyme. In these cases, the initial-rate assumption becomes impractical, and alternative ... autocatalytic activation of zymogens plays a key role in the regulation of many integrated metabolic systems in living organisms, a detailed kinetic analysis for the au...
Ngày tải lên: 23/03/2014, 13:20
Báo cáo khoa học: "Red blood cell elution time of strains of Newcastle disease virus" pptx
...
Ngày tải lên: 07/08/2014, 18:21
Báo cáo khoa học: "Prediction and prevention of suicide in patients with unipolar depression and anxiety" ppsx
... data available concerning the prevalence, method and lethality of suicide in relationship to different healthcare settings the patients had sought help from. Data so far indicate that most variation ... [6-8,75]. In general, it seems that the same factors and characteris- tics that determine suicidal behaviour in major depressive patients as well as treatment strategies apply for those...
Ngày tải lên: 08/08/2014, 23:20