Báo cáo khoa học: " Evidence for a novel gene associated with human influenza A viruses" pptx

Báo cáo khoa học: " Evidence for a novel gene associated with human influenza A viruses" pptx

Báo cáo khoa học: " Evidence for a novel gene associated with human influenza A viruses" pptx

... process for 1) translation of genomic RNAs or 2) generation of mRNAs with the same sequence as genome strands has been proposed for influenza A virus. A thorough survey and analysis of influenza A ... of swine and avian influenza A viruses in the human population. Background Influenza A viruses have had, and continue to have, an extremely significant deleterious impa...

Ngày tải lên: 12/08/2014, 04:20

12 253 0
Tài liệu Báo cáo khoa học: Evidence for noncooperative metal binding to the a domain of human metallothionein ppt

Tài liệu Báo cáo khoa học: Evidence for noncooperative metal binding to the a domain of human metallothionein ppt

... CA, USA); ammonium formate buffer (Ald- rich, Oakville, ON, Canada); isopropyl-b-d-thiogalactoside (Sigma-Aldrich, Oakville, ON, Canada); ammonium hydrox- ide (BDH Chemicals ⁄ VWR, Mississauga, ... Canada Inc., Mississauga, ON, Canada) in a 1 cm quartz cuvette at room temperature (22 °C) and recorded using the cary win uv scan soft- ware application. The wavelength range of 200–300 nm was ....

Ngày tải lên: 19/02/2014, 00:20

9 533 0
Báo cáo khoa học: Evidence for two different electron transfer pathways in the same enzyme, nitrate reductase A from Escherichia coli potx

Báo cáo khoa học: Evidence for two different electron transfer pathways in the same enzyme, nitrate reductase A from Escherichia coli potx

... time constants corresponding to apparent rate constants are obtained by fitting Eqn (1): DAbs ¼ a þ b e Àct ð1Þ where, DAbs is the variation of absorbance, a and b are amplitude parameters and c is ... spectrophotometer. Analysis of data A personal computer was used to fit experimental data to appropriate equations by nonlinear least squares, using a Newton–Gauss algorithm [24]. Ó FEBS...

Ngày tải lên: 07/03/2014, 15:20

8 443 0
Tài liệu Báo cáo khoa học: Evidence for interactions between domains of TatA and TatB from mutagenesis of the TatABC subunits of the twin-arginine translocase docx

Tài liệu Báo cáo khoa học: Evidence for interactions between domains of TatA and TatB from mutagenesis of the TatABC subunits of the twin-arginine translocase docx

... ggggccgcaacgagcgcctgtggcgg Leu25 to Ala P2 6A P2 6A F cgcaacgactggctgtggcggtaaaaac Pro26 to Ala L6 3A L6 3A F ggagtttcaggacagtgcgaaaaaggttgaaaagg Leu63 to Ala 2R > N R37N F gtagcgggctggattaacgcgttgaattcactggcg ... to Ala F3 9A F3 9A F gcgtcgatcaaaggcgctaaaaaagcaatgagcg Phe39 to Ala 3K > Q K37Q F ggtgcgtcgatccaaggctttcaacaagcaatgag Lys37, Lys40 and Lys41 to Gln TatB mutants E8Q E8Q...

Ngày tải lên: 19/02/2014, 17:20

15 532 0
Tài liệu Báo cáo khoa học: Evidence for proteasome dysfunction in cytotoxicity mediated by anti-Ras intracellular antibodies pdf

Tài liệu Báo cáo khoa học: Evidence for proteasome dysfunction in cytotoxicity mediated by anti-Ras intracellular antibodies pdf

... in anti-Ras-induced apoptosis. A combinatorial approach, consisting of a cancer-specific apoptosis-inducing gene and proteasome inactivation, may be a good rationale for evaluating new strategies ... of proteasome activity than that obtained with 1 l M lactacys- tin (compare lanes 2 and 5). Note that an aggregating molecule, such as the irrelevant anti-NGF scFv fragment, induced de...

Ngày tải lên: 21/02/2014, 00:20

9 624 0
Báo cáo khoa học: Evidence for the presence of ferritin in plant mitochondria pdf

Báo cáo khoa học: Evidence for the presence of ferritin in plant mitochondria pdf

... Mitochondria were isolated from etiolated pea stems and Arabidopsis thaliana cell cultures. The proteins were separated by SDS/PAGE. A protein, with an apparent molecular mass of approximately 25–26 kDa (corresponding ... this paper strongly indicate a mitochondrial localization for ferritins in P. sativum and A. thaliana and could be rationalized as follows: the protein may be targe...

Ngày tải lên: 16/03/2014, 18:20

8 504 0
Báo cáo khoa học: Evidence for the slow reaction of hypoxia-inducible factor prolyl hydroxylase 2 with oxygen pptx

Báo cáo khoa học: Evidence for the slow reaction of hypoxia-inducible factor prolyl hydroxylase 2 with oxygen pptx

... Authors Journal compilation ª 2010 FEBS and distribution of the hypoxia-inducible factors HIF-1alpha and HIF-2alpha in normal human tissues, cancers, and tumor -associated macrophages. Am J Pathol ... targets HIF -a for proteasomal degradation [6,7]. In a separate oxygen-dependent mechanism of HIF regulation, asparaginyl hydroxylation (Asn803) in the HIF -a C-terminal transactivation...

Ngày tải lên: 23/03/2014, 03:20

11 457 0
báo cáo khoa học: " Evidence-informed health policy 1 – Synthesis of findings from a multi-method study of organizations that support the use of research evidence" pptx

báo cáo khoa học: " Evidence-informed health policy 1 – Synthesis of findings from a multi-method study of organizations that support the use of research evidence" pptx

... systematic and transparent meth- ods brought with it a related challenge, namely the time- consuming nature of an evidence- based approach. Start small, have a clear audience and scope, and address ... organiza- tions argued that WHO should play a facilitating role in local adaptation efforts in order to enhance local applica- bility; and 2) the (qualitative) survey finding that some...

Ngày tải lên: 11/08/2014, 16:21

7 261 0
Báo cáo khoa học: "Evidence of recombination in Hepatitis C Virus populations infecting a hemophiliac patient" pdf

Báo cáo khoa học: "Evidence of recombination in Hepatitis C Virus populations infecting a hemophiliac patient" pdf

... 1a United States EF407455 H77 1a United State AF009606 FR5 2a France L38334 NDM59 2a Japan AF169005 JCH-6 2a Japan AB047645 HC-J7 2b Japan D10077 MD2B-1 2b Japan AF238486 TN9-0FL 2b United State ... Okamoto HS, Okada S, Sugiyama Y, Kurai K, Lizuka H, Machida A, Miyakawa Y, Mayumi M: Nucleotide sequence of the genomic RNA of hepatitis C virus isolated from a human carrier: com- pari...

Ngày tải lên: 12/08/2014, 04:20

9 172 0
báo cáo khoa học: " Evidence for the rapid expansion of microRNA-mediated regulation in early land plant evolution" docx

báo cáo khoa học: " Evidence for the rapid expansion of microRNA-mediated regulation in early land plant evolution" docx

... 2-15 1 UGACAACGAGAGAGAGUACGCU 22 |||||||||||||||| |||| ppt-miR53 5a 1 UGACAACGAGAGAGAGCACGC 21 3-40 1 UGACAGAAGAGAGUGAGCACAU 22 |||||||||||||||||||| ath-miR156g 1 CGACAGAAGAGAGUGAGCACA 21 ... no 2–15 b UGACAACGAGAGAGAGUACGCU 22 miR535 (ppt, osa) n.f. n.f. n.e. 3–40 b UGACAGAAGAGAGUGAGCACAU 22 miR156 (ath, gma, mtr, osa ptc, sbi, sof, zma, ppt) n.f. n.f. n.e. 3–44 c UCGGAAGCCUUUGUGGG...

Ngày tải lên: 12/08/2014, 05:20

19 329 0
w