Báo cáo khoa học: " Correlation between HIV viral load and aminotransferases as liver damage markers in HIV infected naive patients: a concordance cross-sectional study" pdf
... which HIV causes hepatic damage are still unknown. Our aim was to determine the correlation between HIV viral load, and serum levels of aspartate aminotransferase (AST) and alanine aminotransferase ... Central Page 1 of 4 (page number not for citation purposes) Virology Journal Open Access Short report Correlation between HIV viral load and aminotransferases as...
Ngày tải lên: 12/08/2014, 04:20
... observations indicating that calpain and calpast- atin can associate in a 1 : 1 molar ratio, regardless of the presence of Ca 2+ (unpublished work). In addition to Ca 2+ and calpastatin, a number ... these structural changes must precede the calpain active state. As shown in Fig. 3, when calpain was exposed to increasing concentrations of recombinant calpastatin RNCAST104, the...
Ngày tải lên: 07/03/2014, 12:20
... Desmadril M, Minard P, Ballery N, Gaillard-Miran S, Hall L & Yon JM (1991) Conformational changes in yeast phosphoglycerate kinase upon ligand binding: Substrate-assisted domain–domain cooperativity ... 3-phosphoglycerate kinase Andrea Varga 1 , Bea ´ ta Flachner 1 ,E ´ va Gra ´ czer 1 , Szabolcs Osva ´ th 2 , Andrea N. Szila ´ gyi 1 and Ma ´ ria Vas 1 1 Institute of Enzymology, Biolo...
Ngày tải lên: 16/03/2014, 18:20
Báo cáo khoa học: "Correlation between ROUGE and Human Evaluation of Extractive Meeting Summaries" pptx
... summarization evaluation can be broadly clas- sified into two categories (Jones and Galliers, 1996): in- trinsic and extrinsic evaluation. Intrinsic evaluation, such as relative utility based ... meeting characteristics, such as disfluencies and speaker information, especially when evaluating system-generated summaries. 1 Introduction Meeting summarization has drawn an increasing at...
Ngày tải lên: 17/03/2014, 02:20
Báo cáo khoa học: Correlation between functional and structural changes of reduced and oxidized trout hemoglobins I and IV at different pHs doc
... recording were accumu- lated for each sample. Peroxidase activity assay The assay for peroxidase activity was performed as reported by Everse et al. [6] using guaiacol as substrate. Fifty millimolar ... pH decrease, remaining in the R conformational state also at low pH. On the contrary, the pH decrease induces similar structural changes, characteristics of ligand dissociation and R fi...
Ngày tải lên: 23/03/2014, 12:20
báo cáo khoa học:" Correlation between adherence rates measured by MEMS and self-reported questionnaires: a meta-analysis" pps
... methods, and study durations that were involved in the original trials. Publication bias was examined using the Begg-adjusted rank correlation test based on Kendall’ s score and Egger regression asym- metric ... as measuring adher- ence were in HIV and few were in hypertension, schizo- phrenia and diabetes. Conclusion Based on the pooled estimate using meta-analysis, at le...
Ngày tải lên: 12/08/2014, 01:21
Tài liệu Báo cáo khoa học: Competition between innate multidrug resistance and intracellular binding of rhodamine dyes pdf
... subline was obtained by sequential exposure of cells to increasing concentrations of doxorubicin and was maintained in the presence of 0.5 lm doxorubicin. A total of 2008 parental cells and their ... dyes entering the cells remain free in the cytoplasm and are passively bound to various intracellular sites. Likely sites are the intracellular membranes because they are hydrophobic...
Ngày tải lên: 18/02/2014, 13:20
Báo cáo khoa học: Interactions between coenzyme B12 analogs and adenosylcobalamin-dependent glutamate mutase from Clostridium tetanomorphum pot
... to assay glutamate mutase activity [22]. The assay was made irreversible by coupling the formation of 3-methylaspartate to the pro- duction of mesaconate through deamination by methylas- partase. ... reaction was initiated by adding l-glutamate and incubating at room temperature for 15 min. The formation of mesaconate was then analyzed by reverse-phase HPLC on a C 18 column (4.6 · 250 mm)...
Ngày tải lên: 07/03/2014, 04:20
Báo cáo khoa học: "Mapping between Compositional Semantic Representations and Lexical Semantic Resources: Towards Accurate Deep Semantic Parsing" docx
... grammars with a semantic interface for scalable machine translation. In Proceedings of the 10th Machine Translation Summit, pages 165 – 172, Phuket, Thailand. Dan Flickinger. 2002. On building ... Resources: Towards Accurate Deep Semantic Parsing Sergio Roa†‡, Valia Kordoni† and Yi Zhang† Dept. of Computational Linguistics, Saarland University, Germany† German Research Center for Artific...
Ngày tải lên: 08/03/2014, 01:20
Báo cáo sinh học: "Correlation between LTR point mutations and proviral load levels among Human T cell Lymphotropic Virus type 1 (HTLV-1) asymptomatic carriers" potx
... clinical isolates. PCR was performed using the primers HFL1 (39) (5' CCCAAGCTTGACAATGACCATGAGC 3') and HFL2 (782) (5'CCCGAATTCCAACTGTGTACTAAATTTC 3') and in conditions as ... Sugimoto M, Nakashima H, Watanabe S, Uyama E, Tanaka F, Ando M, Araki S, Kawasaki S: T-lymphocyte alveolitis in HTLV-I-associated myelopathy. Lancet 1987,2(8569):1220. 7. Kawai H, Saito...
Ngày tải lên: 18/06/2014, 18:20