Báo cáo khoa học: " Characterization of untranslated regions of the salmonid alphavirus 3 (SAV3) genome and construction of a SAV3 based replicon" ppsx

Báo cáo khoa học: Methylcitrate synthase from Aspergillus fumigatus Propionyl-CoA affects polyketide synthesis, growth and morphology of conidia ppt

Báo cáo khoa học: Methylcitrate synthase from Aspergillus fumigatus Propionyl-CoA affects polyketide synthesis, growth and morphology of conidia ppt

... 5¢ 3 cDNAmcsAAf_up GAC CAT CCC TTG ATA GCA TC cDNAmcsAAf_down GAT ATC ACA GGC TCA CAG G NotMcsAAf_up CCG CCT TCA GAG CGG TCT TG NotMcsAAf_down CCG CCT CCG GAG TCC TCT TC AfumMcsAup GGC CTG AGG ... dehy- drogenase from rabbit muscle (Roche Diagnostics, Mann- heim, Germany) as described in [3] . Determination of acyl-CoA synthetase activity and preparation of intracellular acyl-CoA Acety...

Ngày tải lên: 23/03/2014, 15:20

16 325 0
báo cáo khoa học: "Parthenocarpic potential in Capsicum annuum L. is enhanced by carpelloid structures and controlled by a single recessive gene" docx

báo cáo khoa học: "Parthenocarpic potential in Capsicum annuum L. is enhanced by carpelloid structures and controlled by a single recessive gene" docx

... aberrant form of Ara- bidopsis ARF8 also conferred parthenocarpy in Arabi- dopsis and tomato, indicating ARF8 as an important regulator in the control of fruit set [4]. Mapping of a parthenocarpic QTL ... 7). Line 3 was used as a parthenocarpic parent (Pp) and Lamuyo B, ORF2#1, and Parco as non-parthenocarpic parents (Pn). F 2 progenies were obtained for all three crosses,...

Ngày tải lên: 11/08/2014, 11:21

15 374 0
Báo cáo khoa học: " Characterization of untranslated regions of the salmonid alphavirus 3 (SAV3) genome and construction of a SAV3 based replicon" ppsx

Báo cáo khoa học: " Characterization of untranslated regions of the salmonid alphavirus 3 (SAV3) genome and construction of a SAV3 based replicon" ppsx

... in Cloning and characterization of SAV3 5'- and 3& apos;-endsFigure 1 Cloning and characterization of SAV3 5'- and 3& apos;-ends. The 5'- and 3& apos;-ends of SAV3 were cloned and sequenced ... citation purposes) Virology Journal Open Access Short report Characterization of untranslated regions of the salmonid alphavirus 3 (SA...

Ngày tải lên: 12/08/2014, 04:20

6 270 0
Báo cáo khoa học: Characterization of the 5¢ untranslated region of a and b isoforms of the human thromboxane A2 receptor (TP) Differential promoter utilization by the TP isoforms doc

Báo cáo khoa học: Characterization of the 5¢ untranslated region of a and b isoforms of the human thromboxane A2 receptor (TP) Differential promoter utilization by the TP isoforms doc

... generate the recombinant plasmids pGL3b:Prm1; pGL3b:Prm2 and pGL3b:Prm3, each in pGL3Basic and pGL3e:Prm1; pGL3e:Prm2 and pGL3e:Prm3, each in pGL3Enhancer. The fidelity of all recombinant plasmids ... TXA 2 synthase, acts as a potent agonist of platelet activation and aggregation and mediates a diversity of actions in a number of other target cell or tissue types [1...

Ngày tải lên: 31/03/2014, 09:20

16 321 0
Tài liệu Báo cáo khoa học: Characterization of 1H NMR detectable mobile lipids in cells from human adenocarcinomas doc

Tài liệu Báo cáo khoa học: Characterization of 1H NMR detectable mobile lipids in cells from human adenocarcinomas doc

... from human adenocarcinomas Anna Maria Luciani 1 , Sveva Grande 1 , Alessandra Palma 1 , Antonella Rosi 1 , Claudio Giovannini 2 , Orazio Sapora 3 , Vincenza Viti 1 and Laura Guidoni 1 1 Dipartimento ... irradiated: black) and A ⁄ (Lys + Ala) (controls: dotted white; irradiated: dotted black) as obtained from 1D and 2D COSY spectra of HeLa and MCF-7 cell samples. Data are the m...

Ngày tải lên: 18/02/2014, 13:20

14 765 0
Tài liệu Báo cáo khoa học: Characterization of chitinase-like proteins (Cg-Clp1 and Cg-Clp2) involved in immune defence of the mollusc Crassostrea gigas docx

Tài liệu Báo cáo khoa học: Characterization of chitinase-like proteins (Cg-Clp1 and Cg-Clp2) involved in immune defence of the mollusc Crassostrea gigas docx

... with the following primers: QsCgClp1 (5¢-CTTCCTCCGCTTCCATGA -3 ) and QaCgClp1 (5¢-CCATGAAGTCCGCGAATC -3 ); and QsCgClp2 (5¢-GCATAGCGATGTGGACGA -3 ) and QaCgClp2 (5¢-GAGGACCGAGACCGTGAA -3 ). The abbreviations ... Mohanty AK, Singh G, Paramasivam M, Saravanan K, Jabeen T, Sharma S, Yadav S, Kaur P, Kumar P, Srini- vasan A et al. (20 03) Crystal structure of a novel regula- tory...

Ngày tải lên: 19/02/2014, 00:20

9 584 0
Tài liệu Báo cáo khoa học: Characterization of human deoxyribonuclease I gene (DNASE1) promoters reveals the utilization of two transcription-starting exons and the involvement of Sp1 in its transcriptional regulation ppt

Tài liệu Báo cáo khoa học: Characterization of human deoxyribonuclease I gene (DNASE1) promoters reveals the utilization of two transcription-starting exons and the involvement of Sp1 in its transcriptional regulation ppt

... cells and a primer set of the forward pri- mer DN-5R and the reverse primer DN+854X (sequences 5¢-CG GAATTCTCAGGATGAGGGGCATGAAG -3 and 5¢-CG CTCGAGGCTGCTCACTTCAGCATCAC -3 , res- pectively) and directionally ... Kominato Y, Yamamoto F & Takizawa H (2002) Characterization of the human ABO gene pro- moter in erythroid cell lineage. Vox Sang 82, 39 –46. 34 Yasuda T, Aw...

Ngày tải lên: 19/02/2014, 06:20

12 610 0
Tài liệu Báo cáo khoa học: Characterization of the interaction between the plasma membrane H+-ATPase of Arabidopsis thaliana and a novel interactor (PPI1) doc

Tài liệu Báo cáo khoa học: Characterization of the interaction between the plasma membrane H+-ATPase of Arabidopsis thaliana and a novel interactor (PPI1) doc

... FEBS Characterization of the interaction between the plasma membrane H + -ATPase of Arabidopsis thaliana and a novel interactor (PPI1) Corrado Viotti, Laura Luoni, Piero Morandini and Maria Ida De Michelis Dipartimento ... of the first 88 amino acids of PPI1 may participate in the interaction with the H + -ATPase and makes PPI1 588 His 6 a suitable tool to study...

Ngày tải lên: 19/02/2014, 07:20

8 629 0
Tài liệu Báo cáo khoa học: Characterization of a recombinantly expressed proteinase K-like enzyme from a psychrotrophic Serratia sp. ppt

Tài liệu Báo cáo khoa học: Characterization of a recombinantly expressed proteinase K-like enzyme from a psychrotrophic Serratia sp. ppt

... 5¢-TTGATCGATTCTGTCTATGCCC CA -3 along with the adaptor primers: AP1 (5¢-GTAATAC GACTCACTATAGGGC -3 ) and AP2 (5¢-ACTATAGGG CACGCGTGGT -3 ). Nested PCR was carried out in a final volume of 50 lL containing 1 lL of a genome ... 5¢-GATGAAAATCCTAACCTCTCCCCCGCACAG- 3 ; OP7, 5¢-ACTGCACCTACGGCGGGTCGTTGGTACG TG -3 ; NP4, 5¢-GACACCGTAGGTTGAGCCGCCAATC GTCCC -3 ; NP5, 5¢-CTTTAACTTGTTGGGCAC...

Ngày tải lên: 19/02/2014, 07:20

14 524 0
Tài liệu Báo cáo khóa học: Characterization of the products of the genes SNO1 and SNZ1 involved in pyridoxine synthesis in Saccharomyces cerevisiae pptx

Tài liệu Báo cáo khóa học: Characterization of the products of the genes SNO1 and SNZ1 involved in pyridoxine synthesis in Saccharomyces cerevisiae pptx

... 5¢-ATA CCATGGACAAAACCCACAGTACAATG P1OH 5¢- CATATGCACAAAACCCACAGTAC P2O 5¢-TAT GGATCCTTAATTAGAAACAAACTGTCTGA TAAAC P2OH 5¢- CTCGAGATTAGAAACAAACTGTCTGATAAACC P1Z 5¢-ATA CCATGGCTGGAGAAGACTTTAAGATC P1ZH ... min, the absorbance of the supernatant was read at 36 3 nm. The absorbance of the reduced form of APAD (APADH) was linear over the 2–100 l M range of glutamate with a mola...

Ngày tải lên: 19/02/2014, 12:20

8 650 0
w