Báo cáo khoa học: "Herpes simplex virus type 2 tegument protein UL56 relocalizes ubiquitin ligase Nedd4 and has a role in transport and/or release of virions" ppt
Báo cáo khoa học: "Herpes simplex virus type 2 tegument protein UL56 relocalizes ubiquitin ligase Nedd4 and has a role in transport and/or release of virions" ppt
... protein UL56 relocalizes ubiquitin ligase Nedd4 and has a role in transport and/ or release of virions Yoko Ushijima, Fumi Goshima, Hiroshi Kimura and Yukihiro Nishiyama* Address: Department of Virology, ... that the interaction of the two proteins is dynamic and transient. Given that Nedd4 participates in many cellular trafficking activities includin...
Ngày tải lên: 12/08/2014, 04:20
Báo cáo khoa học: " Herpes simplex virus type 1 and normal protein permeability in the lungs of critically ill patients: a case of low pathogenicity" docx
... presumably surface area into account, the radioactivity ratio represents the ratio of extravascular to intravascular 67 Ga radioactivity. The PLI represents the transport rate of 67 Ga-transferrin from the ... 1-mm aluminium housing cover (35 mm in diameter and 40 mm in height). The front end of each probe has an aluminium flange attached (3 mm in thickness and 70 mm in...
Ngày tải lên: 12/08/2014, 20:20
Báo cáo hóa học: " Herpes simplex virus type-1(HSV-1) oncolytic and highly fusogenic mutants carrying the NV1020 genomic deletion effectively inhibit primary and metastatic tumors in mice" pptx
... R7 020 : A live attenuated recombinant herpes sim- plex virus (HSV) candidate vaccine. In Program and Abstacts of the 32nd Interscience Conference on Antimicrobial Agents and Chemother- apy American ... experiments and participated in drafting the manuscript, VNC participated in the construc- tion and characterization of the viruses, AB was involved in the design and...
Ngày tải lên: 20/06/2014, 01:20
Báo cáo hóa học: " Herpes Simplex Virus Type 1 Us3 Gene Deletion Influences Toll-like Receptor Responses in Cultured Monocytic Cells" pdf
... Forward TAGCAGTCATCCAACAGAATCAT Reverse AATCTTCTGAGTTGATTATGGGTAA TLR4 Forward ACACAGAAGAGCTGGCATGA Reverse GGTTGTCGGGGATTTTGTAG TLR9 Forward CTTCCCTGTAGCTGCTGTCC Reverse CCTGCACCAGGAGAGACAG IFN-α(1/13) ... statistical analyses, and drafted the manuscript. RKM participated in the PCR and protein assays. HK participated in the PCR assays. EB, HSK, MW and TV participated in the de...
Ngày tải lên: 20/06/2014, 01:20
Báo cáo khoa học: "Herpes simplex virus infection in pregnancy and in neonate: status of art of epidemiology, diagnosis, therapy and preventio" potx
... including live and inactivated whole virus vaccines and subunit vaccines consisting of recombinant viral glycoproteins in various adjuvants [ 72] . Although animal studies on vaccination strategies to ... genital and neonatal herpes may be promising, clin- ical trials of HSV -2 vaccines in humans have failed to prove efficacy. In a previous study, an HSV -2 glycoprotein...
Ngày tải lên: 12/08/2014, 04:21
Báo cáo y học: " Herpes simplex virus UL56 interacts with and regulates the Nedd4-family ubiquitin ligase Itch" pps
... virus type 2 tegument protein UL56 relocalizes ubiquitin ligase Nedd4 and has a role in transport and/ or release of virions. Virol J 20 09, 6:168. 13. Dolan A, Jamieson FE, Cunningham C, Barnett ... Nedd4- family ligases: an amino-terminal C2 domain; four protein- protein interacting WW domains, which most commonly recognize PY motifs of binding pro...
Ngày tải lên: 12/08/2014, 04:20
Báo cáo khoa học: Chain initiation on type I modular polyketide synthases revealed by limited proteolysis and ion-trap mass spectrometry doc
... mLÆmin )1 . LM, loading module fragment comprising the didomain AT L -ACP L ; ACP1-M2, tetradomain fragment containing domains ACP1-KS2- AT2-KR2; KR5-ACP5-M6, multidomain fragment containing ... N-terminal sequencing analysis. The acyltransferase-acyl carrier protein required for chain initiation (AT L -ACP L ), was released as a didomain from both DEBS1-TE and DKS, as well as the off-l...
Ngày tải lên: 16/03/2014, 18:20
Báo cáo y học: " Human Immunodeficiency Virus Type 1 Nef protein modulates the lipid composition of virions and host cell membrane microdomains" pot
... cholesterol transport from macrophages. PLoS Biol 20 06, 4(11):e365. 44. Tokunaga K, Kojima A, Kurata T, Ikuta K, Akari H, Koyama AH, Kawamura M, Inubushi R, Shimano R, Adachi A: Enhancement of human immunodeficiency ... protein was held constant. ethanol/cholesterol/cyclo- dextrine was added in increasing amounts up to a molar ratio of protein to ligand of 1 to 2. Compet...
Ngày tải lên: 13/08/2014, 05:22
Báo cáo khoa học: "Septic shock is correlated with asymmetrical dimethyl arginine levels, which may be influenced by a polymorphism in the dimethylarginine dimethylaminohydrolase II gene: a prospective observational study" docx
... on day 1 (r 2 = 0 .28 , n = 40, p = 0.0003). In addition, SOFA Table 1 Locus Primer DDAHII-449 Allele 1 GAAGGTGACCAAGTTCATGCTGACTGGAAGTCCAGCCCGG Allele 2 GAAGGTCGGAGTCAACGGATTGACTGGAAGTCCAGCCCGC Common ... dimethyl- arginine (ADMA) using a novel ELISA assay. Clin Chem Lab Med 20 04, 42: 1377-1383. 19. Vallance P: Importance of asymmetrical dimethylarginine in cardiovascular risk...
Ngày tải lên: 13/08/2014, 03:20
Báo cáo khoa học: "Epstein-Barr virus latent membrane protein-1 (LMP-1) 30-bp deletion and Xho I-loss is associated with type III nasopharyngeal carcinoma in Malaysia" docx
... cases. § Data was only available for 31 out of 34 cases. ¥ Data was only available for 28 out of 29 cases. ∞ Data was only available for 26 out of 29 cases. Ø Data was only available for 27 out of ... of 29 cases. ¤ Data are only available for 16 out of 29 cases. €Data was only available for 38 out of 39 cases. ∂ The data was only available for 36 out of 39 cases...
Ngày tải lên: 09/08/2014, 07:21