Báo cáo khoa học: " Nucleotide identity and variability among different Pakistani hepatitis C virus isolates" potx
Báo cáo khoa học: " Nucleotide identity and variability among different Pakistani hepatitis C virus isolates" potx
... genotype 1 and 4 and 1 and 3 respectively.
Background
Hepatitis C virus (HCV) belongs to the family Flaviviridae,
genus Hepacivirus and is responsible for the second most
common cause of viral hepatitis ... not for citation purposes)
Virology Journal
Open Access
Research
Nucleotide identity and variability among different Pakistani
hepatitis C virus isolate...
Báo cáo y học: "Nucleotide identity and variability among different Pakistani hepatitis C virus isolates" potx
... BioMed Central
Page 1 of 6
(page number not for citation purposes)
Virology Journal
Open Access
Research
Nucleotide identity and variability among different Pakistani
hepatitis C virus isolates
Muhammad ... genotype 1 and 4 and 1 and 3 respectively.
Background
Hepatitis C virus (HCV) belongs to the family Flaviviridae,
genus Hepacivirus and is responsible for...
Báo cáo khoa học: " Conserved peptides within the E2 region of Hepatitis C virus induce humoral and cellular responses in goats" pptx
... fold
increase in HCV antigen specific leucocytes proliferation
indicated that our candidate epitope E2 (p38) vaccine was
able to induce cellular immune response, which was crit-
ical in viral clearance. These ... of selected pep-
tides to induce strong and specific humoral and cellular
immune responses makes them potential candidates for
designing a prophylactic and therapeutic vaccine...
Báo cáo khoa học: "Impaired antiviral activity of interferon alpha against hepatitis C virus 2a in Huh-7 cells with a defective Jak-Stat pathway" pdf
... HCV NS5A was
amplified using sense and anti-sense overlapping primers
(S/7529/GFP- 5’-GCCTCCTCTATGCCCCCCATGGT-
GAGC AAGGGCGAG-3’ and (AS/7547-7564/GFP 5’-
TCCAGGCTCCCCCTCGAGCTTGTACA
GCTCGTCCAT-3’). ... by direct PCR foll owed by Southern
blot analysis for the neo gene (sense 5’-ATCGAATT-
CATCGTGGCTGGCCA-3’ ;anti-sense5’ -CTA-
GAATTCGGCGCGAGCCCCTG-3’ ;probe5’-
GCTTGGTGGTCGAATGGGCAG GTAGCCG...
báo cáo khoa học: " Nucleotide diversity and linkage disequilibrium in 11 expressed resistance candidate genes in Lolium perenne" ppt
... tatatccgccaacttccccg
R
tcaatcatcacctgcccacc
EST28 PKPA 1145 509 + 510 10 F gagcaacaagactgaccatt
R caatctggtttgttcttggc
EST39 PKPA 1500 502 + 475 15 F cacatcatcggattccacaa
R atacatcccaatccacctgg
EST40 ... agcacgccatcactgttcta
R ctagggcatcaaccgactgt
EST45 NBS-LRR 1014 1056 23 F gagcagccttcctccaaact
R
caaggccacgagaactagca
EST13 EDR-1 2200 480 + 479 10 F aagcggaggattaagatggc
R cacatattcacatggga...
Báo cáo khóa học: Purification and functional characterization of insecticidal sphingomyelinase C produced by Bacillus cereus ppt
... insecticidal toxin (SMC)
in
E. coli
The SMC gene amplified by PCR using the vector sense
(VS) (5¢-GGGAATTCCATATGGAAGTGTCTACAA
ATC-3¢) and vector antisense (VA) (5¢-CCGCTCG
AGCTTCATAGAAATAGTCGCCTC-3¢)primerswas
cloned ... introduced by PCR.
Mutagenesis sense (MS) 5¢-GGTACAGCGTTGCAA
GCGG-3¢ and mutagenesis antisense (MA) 5¢-CCGC
TTGCAACGCTGTACC-3¢ primers were designed to
generate the mutati...
Báo cáo khoa học: "KNOWLEDGE ORGANIZATION AND APPLICATION: BRIEF COMIIENTS OF PAPERS IN THE SESSION " potx
... implicit. Quantification is handled
through a set of "structural descriptions." It is not
clear how negation is handled. The main application is
for the command and control of advanced ... not concerned, directly with knowledge
representation. It is concerned with complete and
partial matching procedures, especially for determining
whether a particular instance satisfies t...
báo cáo khoa học: " Methamphetamine use and malnutrition among street-involved youth" potx
... its analogues, and HIV infection:
medical and psychiatric aspects of a new epidemic. Clinical infectious
diseases Chicago, IL: The University of Chicago Press 2004, 38:890.
4. Dachner N, Tarasuk ... of:
• Convenient online submission
• Thorough peer review
• No space constraints or color figure charges
• Immediate publication on acceptance
• Inclusion in PubMed, CAS, Scopus and Google S...
Báo cáo y học: " Mutations in the E2-PePHD region of hepatitis C virus genotype-3a and correlation with response to interferon and ribavirin combination therapy in Pakistani patients" pptx
... as a con-
sequence HCV RNA transcription is halted. However
HCV has also evolved certain mechanisms to overcome
* Correspondence: idreeskhan96@yahoo.com
National Centre of Excellence in Molecular ... their cooperation in the
study.
Authors’ contributions
SA and MI conceived of the study participated in its design and
coordination and gave a critical view of manuscript writing. SA collec...