Báo cáo khoa học: " Nucleotide identity and variability among different Pakistani hepatitis C virus isolates" potx
... genotype 1 and 4 and 1 and 3 respectively. Background Hepatitis C virus (HCV) belongs to the family Flaviviridae, genus Hepacivirus and is responsible for the second most common cause of viral hepatitis ... not for citation purposes) Virology Journal Open Access Research Nucleotide identity and variability among different Pakistani hepatitis C virus isolate...
Ngày tải lên: 12/08/2014, 04:20
... BioMed Central Page 1 of 6 (page number not for citation purposes) Virology Journal Open Access Research Nucleotide identity and variability among different Pakistani hepatitis C virus isolates Muhammad ... genotype 1 and 4 and 1 and 3 respectively. Background Hepatitis C virus (HCV) belongs to the family Flaviviridae, genus Hepacivirus and is responsible for...
Ngày tải lên: 12/08/2014, 04:20
... fold increase in HCV antigen specific leucocytes proliferation indicated that our candidate epitope E2 (p38) vaccine was able to induce cellular immune response, which was crit- ical in viral clearance. These ... of selected pep- tides to induce strong and specific humoral and cellular immune responses makes them potential candidates for designing a prophylactic and therapeutic vaccine...
Ngày tải lên: 12/08/2014, 04:21
Báo cáo khoa học: "Impaired antiviral activity of interferon alpha against hepatitis C virus 2a in Huh-7 cells with a defective Jak-Stat pathway" pdf
... HCV NS5A was amplified using sense and anti-sense overlapping primers (S/7529/GFP- 5’-GCCTCCTCTATGCCCCCCATGGT- GAGC AAGGGCGAG-3’ and (AS/7547-7564/GFP 5’- TCCAGGCTCCCCCTCGAGCTTGTACA GCTCGTCCAT-3’). ... by direct PCR foll owed by Southern blot analysis for the neo gene (sense 5’-ATCGAATT- CATCGTGGCTGGCCA-3’ ;anti-sense5’ -CTA- GAATTCGGCGCGAGCCCCTG-3’ ;probe5’- GCTTGGTGGTCGAATGGGCAG GTAGCCG...
Ngày tải lên: 12/08/2014, 04:21
báo cáo khoa học: " Nucleotide diversity and linkage disequilibrium in 11 expressed resistance candidate genes in Lolium perenne" ppt
... tatatccgccaacttccccg R tcaatcatcacctgcccacc EST28 PKPA 1145 509 + 510 10 F gagcaacaagactgaccatt R caatctggtttgttcttggc EST39 PKPA 1500 502 + 475 15 F cacatcatcggattccacaa R atacatcccaatccacctgg EST40 ... agcacgccatcactgttcta R ctagggcatcaaccgactgt EST45 NBS-LRR 1014 1056 23 F gagcagccttcctccaaact R caaggccacgagaactagca EST13 EDR-1 2200 480 + 479 10 F aagcggaggattaagatggc R cacatattcacatggga...
Ngày tải lên: 12/08/2014, 05:20
Báo cáo khóa học: Purification and functional characterization of insecticidal sphingomyelinase C produced by Bacillus cereus ppt
... insecticidal toxin (SMC) in E. coli The SMC gene amplified by PCR using the vector sense (VS) (5¢-GGGAATTCCATATGGAAGTGTCTACAA ATC-3¢) and vector antisense (VA) (5¢-CCGCTCG AGCTTCATAGAAATAGTCGCCTC-3¢)primerswas cloned ... introduced by PCR. Mutagenesis sense (MS) 5¢-GGTACAGCGTTGCAA GCGG-3¢ and mutagenesis antisense (MA) 5¢-CCGC TTGCAACGCTGTACC-3¢ primers were designed to generate the mutati...
Ngày tải lên: 30/03/2014, 13:20
Báo cáo khoa học: "KNOWLEDGE ORGANIZATION AND APPLICATION: BRIEF COMIIENTS OF PAPERS IN THE SESSION " potx
... implicit. Quantification is handled through a set of "structural descriptions." It is not clear how negation is handled. The main application is for the command and control of advanced ... not concerned, directly with knowledge representation. It is concerned with complete and partial matching procedures, especially for determining whether a particular instance satisfies t...
Ngày tải lên: 31/03/2014, 17:20
Báo cáo khoa học: "Surgical treatment and histopathology of different forms of olecranon and presternal bursitis in cattle and buffalo" docx
...
Ngày tải lên: 07/08/2014, 18:21
báo cáo khoa học: " Methamphetamine use and malnutrition among street-involved youth" potx
... its analogues, and HIV infection: medical and psychiatric aspects of a new epidemic. Clinical infectious diseases Chicago, IL: The University of Chicago Press 2004, 38:890. 4. Dachner N, Tarasuk ... of: • Convenient online submission • Thorough peer review • No space constraints or color figure charges • Immediate publication on acceptance • Inclusion in PubMed, CAS, Scopus and Google S...
Ngày tải lên: 11/08/2014, 18:20
Báo cáo y học: " Mutations in the E2-PePHD region of hepatitis C virus genotype-3a and correlation with response to interferon and ribavirin combination therapy in Pakistani patients" pptx
... as a con- sequence HCV RNA transcription is halted. However HCV has also evolved certain mechanisms to overcome * Correspondence: idreeskhan96@yahoo.com National Centre of Excellence in Molecular ... their cooperation in the study. Authors’ contributions SA and MI conceived of the study participated in its design and coordination and gave a critical view of manuscript writing. SA collec...
Ngày tải lên: 11/08/2014, 21:21