Báo cáo y học: "Molecular epidemiology of Hepatitis C virus genotypes in Khyber Pakhtoonkhaw of Pakistan" pptx

Báo cáo y học: "Molecular epidemiology of Hepatitis C virus genotypes in Khyber Pakhtoonkhaw of Pakistan" pptx

Báo cáo y học: "Molecular epidemiology of Hepatitis C virus genotypes in Khyber Pakhtoonkhaw of Pakistan" pptx

... still common in the coun- tryside especially in KPK province which needs effective check for minimizing the spread of HCV infection and the transmission of other communicable diseases. Theonlylimitationofthisstudyisthedetectionof large ... a number of patients in the past. Mass vaccination in the recent past in which un-sterilized syringes were used might have enhanced the inf...

Ngày tải lên: 12/08/2014, 04:20

7 368 0
Báo cáo y học: "Molecular epidemiology of hepatitis E virus infections in Shanghai, China" ppt

Báo cáo y học: "Molecular epidemiology of hepatitis E virus infections in Shanghai, China" ppt

... Keywords Hepatitis E virus, Epidemiology, Shanghai municipality, Virus genotypes, Virus subtypes Findings Hepatitis E virus (HEV), the causative agent of acute or fulminant hepatitis in humans, ... geographically exclusively to Shanghai and its neighboring provinces, the municipality, as a major industrial and commercial center, is deserving of close attention with re...

Ngày tải lên: 11/08/2014, 21:22

10 364 0
Báo cáo y học: " Molecular epidemiology of Japanese encephalitis virus circulating in South Korea, 1983-2005" doc

Báo cáo y học: " Molecular epidemiology of Japanese encephalitis virus circulating in South Korea, 1983-2005" doc

... 7:127 http://www.virologyj.com/content/7/1/127 Page 6 of 7 tal evidence that RNA recombination occurs in JEV [26]. This genotypic conflict may be confirmed by sequencing the E gene again or, more effectively, the ... mosquito collection sites are indi- cated as closed circles. Youngkwang and Wando are located in Jeon- Nam Province. Gunsan is located in Jeon-Buk Province. Figure 2 Nucl...

Ngày tải lên: 12/08/2014, 04:20

7 356 0
Báo cáo y học: " Molecular epidemiology of salmonid alphavirus (SAV) subtype 3 in Norway" pptx

Báo cáo y học: " Molecular epidemiology of salmonid alphavirus (SAV) subtype 3 in Norway" pptx

... AGGATGTAGTGGCCGGTGG C- E3-E2-6K F2234 CGGGTGAAACATCTCTGCG SAV20R GGCATTGCTGTGGAAACC C- E3-E2-6K E2666F GCGACCGTTACCTTTACCAGCG E2YR CAGCACAGTCTGCAGTGTCTAAG nsP3 nsP3YF GAAAGTGGCGGAGATCCTCA nsP3940R TGAGCGGCAGTTTGAATGC nsP3 ... for 15 minutes at 95 C, followed by 40 amplification cycles of 94 C 30 sec, 59 C 30 sec and 72 C 90 sec, and finally 72 C for 10 min. The RT-PCR products were ex...

Ngày tải lên: 12/08/2014, 04:20

8 262 0
Báo cáo y học: " Distribution of hepatitis C virus genotypes in patients infected by different sources and its correlation with clinical and virological parameters: a preliminary study" pptx

Báo cáo y học: " Distribution of hepatitis C virus genotypes in patients infected by different sources and its correlation with clinical and virological parameters: a preliminary study" pptx

... histology with the pre- dominance of different genotypes. Accurate knowledge of HCV genotypes in our community is essential for success- ful future research into vaccine development and control strategy. ... risk factors in hepatitis C virus (HCV) infected patients in Iran is limited. The aim of this study was to identify the HCV genotypes and associated risk factors i...

Ngày tải lên: 13/08/2014, 13:20

6 337 0
Báo cáo y học: "Extracellular mitochondrial DNA and oxidatively damaged DNA in synovial fluid of patients with rheumatoid arthritis" potx

Báo cáo y học: "Extracellular mitochondrial DNA and oxidatively damaged DNA in synovial fluid of patients with rheumatoid arthritis" potx

... exact test. Results Optimization of the PCR conditions The optimum concentration of MgCl 2 for PCR amplifica- tion of mtDNA was determined by analyzing PCR reac- tions containing various concentrations ... factor; ExART, having extra-articular manifestations of RA; CRP, C- reactive protein; TPC, thrombocyte particle count; LPC, leukocyte particle count, n.d., not done. Table 2 Correl...

Ngày tải lên: 09/08/2014, 01:23

7 308 0
Báo cáo y học: "The role played by cell-substrate interactions in the pathogenesis of osteoclast-mediated peri-implant osteolysis" potx

Báo cáo y học: "The role played by cell-substrate interactions in the pathogenesis of osteoclast-mediated peri-implant osteolysis" potx

... appropriate culture conditions they could be induced ex vivo to differentiate into multinucleated cells with the full func- tional and cytochemical characteristics of osteoclasts. These findings received ... expression were much lower in cells associated with polyethylene particles. High levels of β 3 integrin protein were detected in cells in contact with bone. Multinucleated cell...

Ngày tải lên: 09/08/2014, 07:20

10 386 0
Báo cáo y học: " Ethnoveterinary plant remedies used by Nu people in NW Yunnan of China" potx

Báo cáo y học: " Ethnoveterinary plant remedies used by Nu people in NW Yunnan of China" potx

... Kunming Yunnan 650034, PR China. 2 Kunming Institute of Botany, Chinese Academy of Sciences, Kunming 650204, PR China. 3 Pratacultural Science Department, Yunnan Agriculture University, Kunming ... a factor influencing farmers’ choices. The factors influencing treatment decisions are related to farmers’ access to services and to the charac- teristics of service providers. In the case...

Ngày tải lên: 10/08/2014, 09:21

10 459 0
Báo cáo y học: " Rates and risks for prolonged grief disorder in a sample of orphaned and widowed genocide survivors" potx

Báo cáo y học: " Rates and risks for prolonged grief disorder in a sample of orphaned and widowed genocide survivors" potx

... Miller PD, Flynn BW, Doughty DE, Tucker P, Dickson WL: Traumatic Grief in a Convenience Sample of Victims Seeking Support Services After a Terrorist Incident. Annals of Clinical Psychology 2001, 13(1):19-24. 22. ... Phenomenology and Correlates of Complicated Grief in Children and Adolescents. Journal of the American Academy of Child and Adolescent Psychiatry 2007, 46:493-499. 2...

Ngày tải lên: 11/08/2014, 16:22

9 501 0
Báo cáo y học: "Pro/con clinical debate: Are steroids useful in the management of patients with septic shock" ppt

Báo cáo y học: "Pro/con clinical debate: Are steroids useful in the management of patients with septic shock" ppt

... Division of Critical Care Medicine, Mount Sinai Hospital, Toronto, Canada **Fellow in Critical Care Medicine, Division of Critical Care, University of British Columbia, Vancouver, Canada †† Professor ... Canada †† Professor of Medicine, Division of Critical Care, University of British Columbia, Vancouver, Canada Correspondence: Critical Care Forum Editorial Office, editorial@ccf...

Ngày tải lên: 12/08/2014, 18:21

4 317 0
Từ khóa:
w