Báo cáo y học: " A 176 amino acid polypeptide derived from the mumps virus HN ectodomain shows immunological and biological properties similar to the HN protein" pdf
Báo cáo y học: " A 176 amino acid polypeptide derived from the mumps virus HN ectodomain shows immunological and biological properties similar to the HN protein" pdf
... article as: Herrera et al.: A 176 amino acid polypeptide derived from the mumps virus HN ectodomain shows immunological and biological properties similar to the HN protein. Virology Journal 2010 7:195. Submit ... measles -mumps- rubella vaccination. Pediatrics 2002, 110:957-963. 3. Nagai T, Okafuji T, Miyazaki C, Ito Y, Kamada M, Kumagai T, Yuri K,...
Ngày tải lên: 12/08/2014, 04:20
Báo cáo y học: "A single amino acid substitution of the human immunodeficiency virus type 1 capsid protein affects viral sensitivity to TRIM5α" potx
... not affect the association between CA and CypA or Gag processing To clarify whether the 116th amino acid substitution affects the association of CypA with CA, the CypA con- tent in the wild type ... University, Osaka 565-0871, Japan and 2 Max Planck Institute for Informatics, Campus E1.4, 66123 Saarbrücken, Germany References 1. Shibata R, Sakai H, Kawamura M, Tokunaga...
Ngày tải lên: 13/08/2014, 01:20
Báo cáo y học: " Incorporation of podoplanin into HIV released from HEK-293T cells, but not PBMC, is required for efficient binding to the attachment factor CLEC-2" ppsx
... shRNA137sense_BamHI: 5'GATCCGC- GAAGATGAT GTGGTGACTTTCAAGAGAAGT- CACC ACATCATCTTCGTTTTTTACGCGTG3' and shRNA137antisense_EcoRI: 5'AATTCACGCGTAAAAA ACGAAGATGATGTGGTGACTTCTCTTGAAAGTCA CCACATCATCTTCGCG3' ... 103:2648-2654. 27. Sakuntabhai A, Turbpaiboon C, Casademont I, Chuansumrit A, Lowhnoo T, Kajaste-Rudnitski A, Kalayanarooj SM, Tangnararatchakit K, Tangthawornchaik...
Ngày tải lên: 12/08/2014, 23:23
Tài liệu Báo cáo khoa học: A single amino acid substitution of Leu130Ile in snake DNases I contributes to the acquisition of thermal stability A clue to the molecular evolutionary mechanism from cold-blooded to warm-blooded vertebrates docx
... quadrivirgata , E. climacophora and A. blomhoffii DNases I Total RNA was isolated from each snake pancreas by the acid guanidinium thiocyanate/phenol/chloroform method [24] and any DNA contamination ... evolutionary analysis of the DNase I family. The mammalian group formed a relatively tight cluster, while the snake (E. quadrivirgata, E. climacophora and A. blomhoffii), am...
Ngày tải lên: 20/02/2014, 23:20
Báo cáo Y học: tRNA-dependent amino acid discrimination by yeast seryl-tRNA synthetase pdf
... less than those of class I. Class II phenylalanyl-tRNA synthetase (PheRS) specifically deacy- lates Ile–tRNA Phe [13], and alanyl-tRNA synthetase (AlaRS) has been shown to hydrolyze misactivated ... Alternatively, the quality of aminoacyl-tRNA synthesis in the cell can be improved by the tRNA-mediated mechanisms that enhance the accuracy of amino acid discrimination. These are...
Ngày tải lên: 31/03/2014, 08:20
Báo cáo y học: " Conserved charged amino acid residues in the extracellular region of sodium/iodide symporter are critical for iodide transport activity" potx
... mutated NIS DNAs. Twenty-four hours later, the iodide uptake activity was analyzed by steady-state iodide uptake assay and the transfection efficiency was monitored by b-galactosidase assay. As ... Faham S, Watanabe A, Besserer GM, Cascio D, Specht A, Hirayama BA, Wright EM, Abramson J: The crystal structure of a sodium galactose transporter reveals mechanistic insights into Na+/s...
Ngày tải lên: 10/08/2014, 05:21
báo cáo khoa học: "A single amino acid change within the R2 domain of the VvMYB5b transcription factor modulates affinity for protein partners and target promoters selectivity" docx
... T, Haruta KS, Pitaksutheepong C, Abe Y, Kakizaki Y, Yamamoto K, Shimada N, Yamamura S, Nishihara M: Identification and characterization of R2R3-MYB and bHLH transcription factors regulating anthocyanin biosynthesis ... primers pairs: F, 5’- AGATCCTAATACGACTCACTATAGGGAGCC ACCATGAGGAATGCATCCTCAGCA and R, 5’-(T) 32 TCAGAACCGCTTATCAGGTTG. The PCR products were used as template. A 5 μl...
Ngày tải lên: 11/08/2014, 11:21
Báo cáo y học: " Conversion of amino-acid sequence in proteins to classical music: search for auditory patterns" doc
... which similar amino acids were paired initially. Thus, aspartic acid and glutamic acid were paired, as were leucine and isoleucine, tyrosine and phenylalanine, valine and alanine, threonine and ... span- ning such large ranges typically yield scores that lack musicality. They also examined a nine-note scale, but without distinguishing among amino acids having the same...
Ngày tải lên: 14/08/2014, 07:21
Báo cáo y học: " A Dietary Supplement Containing Standardized Phaseolus vulgaris Extract Influences Body Composition of Overweight Men and Women"
... Some dietary carbohydrates have a physical form that makes them inaccessible to a- amylase and, therefore, resistant to digestion in the human gastrointestinal tract. These resistant starches ... purified alpha-amylase inhibitor from white kidney bean (Phaseolus vulgaris). Food Re- search International, 1998; 31:217-225. 17. Hansawasdi C, Kawabata J, Kasai T. Alpha-amylase inh...
Ngày tải lên: 31/10/2012, 15:12
Báo cáo khoa học: Two L-amino acid oxidase isoenzymes from Russell’s viper (Daboia russelli russelli) venom with different mechanisms of inhibition by substrate analogs pdf
... LAAO activity of each fraction was assayed using the coupled assay system, and the pH of each fraction was checked with a pH meter S. Mandal and D. Bhattacharyya Inhibitor-binding sites of L -amino ... a ligand to enter and anchor at the respective functional sites of LAAO that may facilitate the design of suicidal inhibitors. Abbreviations LAAO, L -amino acid oxidase;...
Ngày tải lên: 07/03/2014, 05:20