... These measures can reveal important effects of care that are not reflected in the odds ratio, a statistic often reported for binary data [5,7]. Clearly, binary analysis is appropriate with naturally dichotomous ... by a chiropractor for the care of cervicogenic headache [11,13]. Spinal manipulation had a clinically important advantage over light massage in headache pain, number, and...
Ngày tải lên: 13/08/2014, 14:20
Báo cáo y học: "Isolation of mixed subtypes of influenza A virus from a bald eagle (Haliaeetus leucocephalus)" pptx
... leucocephalus) Sagar M Goyal * , Naresh Jindal, Yogesh Chander, Muthanan A Ramakrishnan, Patrick T Redig, Srinand Sreevatsan Abstract From April 2007 to March 2008, cloacal swabs were obtained from 246 casualty ... characterization of two subtypes of AIV from a single bald eagle (Haliaeetus leucocephalus). From April 2007 to March 2008, under an NIH funded surveillan...
Ngày tải lên: 12/08/2014, 04:20
... Paper ISOLATION OF CHLAMYDIA PNEUMONIAE FROM SERUM SAMPLES OF THE PATIENTS WITH ACUTE CORONARY SYNDROME Ivan M Petyaev 1 , Nayilia A Zigangirova 2 , Alexey M Petyaev 3 , Ulia P Pashko 2 , Lubov ... OmpA of C. pneumoniae was employed. The outer (oCP1 – 5’ TTACAAGCCTTGCCTGTAGG 3’, oCP2 – 5’ GCGA TCCCAAATGTTTAAGGC 3’) and nested (iCPC - 5’ TTATTAATTGATGGTACAATA 3’, iCPD - 5’...
Ngày tải lên: 26/10/2012, 08:57
Báo cáo Y học: Isolation and characterization of a thioredoxin-dependent peroxidase from Chlamydomonas reinhardtii doc
... of Brassica, spinach, barley and A. thaliana,PR1ofPhaseolus and MHF 9 of A. thaliana. These proteins b elong to the 2Cys-Prx subfamily. A ll plan t 2Cys-Prx proteins, except BAS1 of barley, the ... 2002 RESULTS Isolation of a 2Cys-Prx by using a single cysteine mutant of Chlamydomonas Trx h In an attempt to isolate new T rx targets in Chlamydomonas, a s trategy w as used b...
Ngày tải lên: 08/03/2014, 16:20
Báo cáo Y học: Isolation, enzymatic properties, and mode of action of an exo-1,3-b-glucanase from Trichoderma viride doc
... laminarans by MALDI and FAB mass spectrometry. Carbohydr. Res. 310, 203–210. 56. Elyakova, L .A. & Zvyagintseva, T.N. (1974) A study of the laminarins of some Far-Eastern, brown seaweeds. Carbohydr ... digitata. The mode of action of the exo-1,3-b-glucanase on laminarin from L. digitata was studied qualitatively by TLC and quantitatively by HPLC. HPLC analysis of the reactio...
Ngày tải lên: 24/03/2014, 04:21
Báo cáo Y học: Isolation and characterization of MUC15, a novel cell membrane-associated mucin pot
... + d + Lung c –+ d ND Lymph node c –+ d ND a Primer pair: 5¢-AATACCAAAGAAGCCTACAATG-3¢ and 5¢-GTACGAAGTGGAGGTATGTCATC-3¢. b Primer pair: 5¢-GCCATTT TAGGTGCTATTCTGG-3¢ and 5¢-TATTTTCTTTATCTGAGTTTA-3¢. c Primer pair: ... polyacrylamide gels. Antibody staining of sections from bovine prelactating and lactating mammary gland using monoclonal and polyclonal antibodies has shown that PAS III i...
Ngày tải lên: 24/03/2014, 04:21
Báo cáo y học: " Isolation and characterization of a virus (CvV-BW1) that infects symbiotic algae of Paramecium bursaria in Lake Biwa, Japan" pptx
... sequence BglII AGATCT DraI TTTAAA EcoRV GATATC NdeI CATATG MssI GTTTAAAC Sau3AI GATC SspI ACTAGT SwaI ATTTAAAT XbaI TCTAGA Figure 9 Light (upper) and fluorescence (lower) images of Chlorella variabilis. A: ... ––––– Sampling Sites: 1. Karasuma Pen., 2. Kita-Yamada, 3. Yabase Kihan Is., 4. Ohashi Marina, 5. Wani Fishing Port, 6. Aoyagi Beach, 7. Shirahige Beach, 8. Shin-Asahi Windmill Villa...
Ngày tải lên: 12/08/2014, 01:21
Báo cáo y học: "Isolation and characterization of microparticles in sputum from cystic fibrosis patients" pot
... of MPs and the amount of different antigens the non-parametrical Mann-Whitney test was used. All data were analyzed using Prism 4 (GraphPad Software, Inc., La Jolla, CA). p values of less than ... and hydrostatic pulmonary oedema. Intra-alveolar MPs from ARDS patients contain high levels of tissue factor, show an highly procoagulant activity, and are likely contribute to intra-alveo...
Ngày tải lên: 12/08/2014, 11:22
Báo cáo y học: " Isolation of human β-defensin-4 in lung tissue and its increase in lower respiratory tract infection" ppt
... Hirakata Y, Tanaka H, Yoshida R, Tomono K, Koga H, Wada A, Hirayama T, Kamihira S: Evaluation of susceptibility of gram-positive and -negative bacteria to human defensins by using radial diffusion assay. ... Watanabe M, Yamashita T, Ogawa Y, Koh H, Hasegawa N, Nakamura H, Asano K, Yamaguchi K, Kotani M, Kotani T, Morisaki H, Takeda J, Kobayashi K, Ogawa S: New bronchoscopic microsam- p...
Ngày tải lên: 12/08/2014, 18:20
Báo cáo y học: " Isolation of a new HIV-2 group in the US" pptx
... epidemiology in Senegal: changes in HIV diversity. AIDS Res Hum Retroviruses 2007, 23:1189-1196. 2. Loeff MF van der, Awasana AA, Sarge-Njie R, Sande M van der, Jaye A, Sabally S, et al.: Sixteen years ... be accurately diagnosed. A falsely negative PCR result may lead clinicians to infer that an individual's infection is latent or that the antibody tests are false posi- tives. These...
Ngày tải lên: 13/08/2014, 05:21