Báo cáo y học: "Egress of HSV-1 capsid requires the interaction of VP26 and a cellular tetraspanin membrane protein" doc

... respectively:5'-GGATCCCGCAG GCC A A AG AC A AC A ATAG TGGTGCCAGTCAAGAGCTGGCACCACTATTGTTGTCTTTGGCCTGtcgtcagctcgtgccgtaagTGAA AC TAGT TACCAGATCATAACAACCCTCAAGAGG GTTGT TATGATC TGGTAACTAGTT TCATTTTTTCTAGA-3' ... 5'-AGGCATGCCCATTGTTATCTG -3' and 5'- GAGA-CAATCGCGAACATCTAC -3', 5'- ATTCCACCCGCATGGAGTTC -3' and 5'- CGGTGATGTTCGTCAG-GACC -3', respectively. Reactions ... lung mRNA library as the target(Supplementary Table 1). These interactions were furtherconfirmed by a β-gal activity assay (Fig. 1a) . One of the VP26 interacting proteins is a cellular membrane...

Báo cáo y học: "Complications after spacer implantation in the treatment of hip joint infections"

... osteosynthesis. One patient had a fracture be-neath the spacer stem and was treated by implanta-tion of an antibiotic-coated prosthesis stem and placement of a spacer head onto the stem. After ... the antibiogram of the causative bacterium and does not endanger the infection sanitation. Careful and frequent monitoring of the laboratory parameters are indicated in the detection of antibiotic-induced ... Isiklar et al. found one case of ARF out of 10 patients after im-plantation of a vancomycin-loaded hip spacer (2-3 g vancomycin / 40 g PMMA) and intravenous admini-stration of the same antibiotic...

Tài liệu Báo cáo Y học: Trehalose-based oligosaccharides isolated from the cytoplasm of Mycobacterium smegmatis Relation to trehalose-based oligosaccharides attached to lipid docx

... well as by MALDI-TOF MS analysis of the products obtained by permethylation and hydrolysis,andalsoby1H-NMR.Oligosaccharide CO3-2 appeared to be a trisaccharide, asMALDI-TOF MS analysis of the ... includes variouspolysaccharides such as mycolic acid–arabinogalactan and lipoarabinomannan, as well as a variety of complex glycoli-pids [1]. Among the interesting and important glycolipds are a number ... 2,3,4-trimethylgalactitol acetate and 2,3,4,6-tetramethylgalacti-tol acetate. As the amount of CO6 available for character-ization was too low for NMR analysis, additional charac-terization was performed...

Báo cáo y học: "Deep transcranial magnetic stimulation for the treatment of auditory hallucinations: a preliminary open-label study" pptx

... department of Beer Ya’akov Mental Health Center and head of the electroconvulsive therapy unit of the Beer Ya’akov Mental HealthCenter. PD is paid by by Beer Ya’akov Mental Health Center. YR ... Beer Ya’akov Mental HealthCenter. ZA works at the Department of Neurobiology of the WeizmannInstitute of Science and also serves as a research consultant for Brainsway. DPis head of the research ... read and approved the final manuscript. RO works at the Beer Ya’akov MentalHealth Center and is paid by the research fund of the Beer Ya’akov MentalHealth Center. KM serves as the director of the...

Báo cáo y học: "Type IX collagen deficiency enhances the binding of cartilage-specific antibodies and arthritis severity" docx

... unchanged throughout the analysis. The total areawas marked manually and the software marked the stainedarea. The software calculated the stained area as a percent-age of the total.StatisticsAll ... primarily an enthesopathy characterized by the proliferation of fibroblasts and the formation of periarticularenthesophytes of cartilage and bone that can result in marginalankylosis. In contrast ... Niwayama G: Entheses and enthesopathy. Anatom-ical, pathological, and radiological correlation. Radiology 1983,146:1-9.29. Pottenger LA, Phillips FM, Draganich LF: The effect of marginalosteophytes...

Báo cáo y học: "Dietary fatty acid intake affects the risk of developing bone marrow lesions in healthy middle-aged adults without clinical knee osteoarthritis: a prospective cohort study" docx

... fatty acids on the inci-dence of BMLs may be attributed to a vascular effect. Satu-rated fatty acid intake has been associated withatherosclerosis and cardiovascular disease [15]. There are ... E, Baranyay F, Wluka AE, Hanna F, Bell RJ, Davis SR,Wang Y, Cicuttini FM: A study of the prevalence and associa-tions of subchondral bone marrow lesions in the knees of healthy, middle-aged ... identifying a relationship between saturatedfatty acid intake and the risk of OA. Recently, it has been sug-gested that atheromatous vascular disease may be importantin the progression of OA [16]...

Báo cáo y học: " Many LINE1 elements contribute to the transcriptome of human somatic cells" pptx

... TATGATTAAAAAAAAAAAGTACTGTAACCAAAAAAAAAAAA5 ’ TATAATAAAAAAAATAAAAAATAAAAAACAACTCTCAGAAGCAAAAAAAAAAAA5 ’ TATAATAAAAAAAAAAGAAGCCAAAAAAAAAAAA5 ’ TATAATAAAAAAAAAAAATTAAAAAAATAAAAAAAAACATATACCTATTGAAGGAAAAAAAAAAAA5 ... TATAATAAAAAAAATAAATAAATAAATAAAAAATAAAATAAAAAACAACTCTCAGAAGCchr4 long tag TATAATAAAAAAAATAAA AAATAAAAAACAACTCTCAGAAGCAAAAAAAAAAAAAAAAAAAAAAAAAAAAGCAATCTTGCAG chr6 transduction TATAATAAAAAAAAAAAT AAATAAAAAACAACTCTCAGAAGCAAAAAAAAAAAAAAAAA ... AAATAAAAAACAACTCTCAGAAGCAAAAAAAAAAAAAAAAA GCAATCTTGCAG chr4 ATATCTGACGAGTCTAAGCTGTTCAAAGATATGTTGCATGGAGAAAATAGAATAGTAGAAACCTAGACAAAGACTGGGAAATAAAGATGGTCTTATCCCCchr6 ATATCTGACCAGTCTAAGCTGTTCAAAGATATGTTGCATGGAGAAAATAGAATAGTAGAAACCTAGACAAAGACTGGGAAATAAAGATGGTCTTATCCCC (A) ...

Báo cáo y học: "Occipital peripheral nerve stimulation in the management of chronic intractable occipital neuralgia in a patient with neurofibromatosis type 1: a case report" pot

... probe was slowly advan ced laterallyat the same level until the greater occipital artery and nerve were visualized as two distinct structures: the artery as a hypoechogenic oval structure and the ... specializ-ing in the treatm ent of daily headaches. She had experi-enced daily intractable headaches since age 18 years.She also had chronic bilateral occipital neur algia on the basis of the ... undergoneextensive medical management with biofeedback train-ing, physical therapy, massage, acupuncture, and phar-macological management with narcotic and non-narcotic pain medications. Her medications includedsustained-releasemorphine(30mgevery12hours),hydrocodone...

Báo cáo y học: "JNK pathway is involved in the inhibition of inflammatory target gene expression and NF-kappaB activation by melittin" ppsx

... NO and PGE2 production viaJNK pathway dependent inactivation of NF-κB, and suggest that inactivation of JNK pathways may also contribute to the anti-inflammatory and anti-arthritis effects of ... Leica Microsystems AG, Wetzlar, Germany)equipped with a 630×oil immersion objective.Statistical analysisData were analyzed using one-way analysis of variancefollowed by Tukey's test as a ... treated Raw264.7 cells and synoviocytes, and SNP treated synovio-vytes. Activation of p38 was also significantly reduced in the LPS treated synoviocytes, and SNP treated Raw 264.7cells and synoviocytes,...

Báo cáo y học: "Severe leukocytoclastic vasculitis secondary to the use of a naproxen and requiring amputation: a case report" ppt

... disease.Noting the atypical nature of the case of LCV or HSV, the authors feel that the realization of paucity of caseswith more severe outcomes may encourage additionalresearch in the area of ... multi-limbischemia and subsequent amputation. Adding yetanother pharmaceutical to the list of potential causes of leukocytoclastic vasculitis will significantly add to ourunderstanding of the etiology of ... use.Her father died at the age of 46 secondary to a myocardialinfarction, and her mother is alive with hypercholester-olemia, diabetes, hypertension and arthritis. She also has a brother with diabetes....

Xem thêm

Từ khóa: Báo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018 Nghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoại Một số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTP Nghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THz Nghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt nam Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit ĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDE Quản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninh Nghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúng Sở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIX Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2 chuong 1 tong quan quan tri rui ro Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Chiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015