Báo cáo y học: "Analysis of the 5''''''''UTR of HCV genotype 3 grown in vitro in human B cells, T cells, and macrophages" potx

Báo cáo y học: " Analysis on the clinical features of 22 basaloid squamous cell carcinoma of the lung" doc

Báo cáo y học: " Analysis on the clinical features of 22 basaloid squamous cell carcinoma of the lung" doc

... was significantly influenced by treatment mode and clinical stage of < /b> the < /b> tumor. The < /b> post-operation mortality hazard of < /b> patients treat ed with a combination of < /b> chemotherapy and radiation therapy was 1.296 times ... and clinical stage of < /b> the < /b> tumor. The < /b> post-operation mortality hazard of < /b> patients treat ed with a combination...

Ngày tải lên: 10/08/2014, 09:23

6 401 0
Báo cáo y học: "Foundation for the Community Control of Hereditary Diseases, Budapest, Hungary"

Báo cáo y học: "Foundation for the Community Control of Hereditary Diseases, Budapest, Hungary"

... syndrome). The < /b> proportion of < /b> genetic origin is estimated about 25 % of < /b> total congenital abnormalities. Mainly two conditions may contribute to a higher total prevalence of < /b> congenital abnormalities ... prenatal diagnosed and terminated affected fetuses and the < /b> term total (birth and fetal) prevalence of < /b> congenital abnormalities is used. Of...

Ngày tải lên: 02/11/2012, 11:12

2 626 0
Báo cáo y học: "Gene Therapy: The Potential Applicability of Gene Transfer Technology to the Human Germline"

Báo cáo y học: "Gene Therapy: The Potential Applicability of Gene Transfer Technology to the Human Germline"

... exogenous DNA becomes concentrated within the < /b> posterior part of < /b> the < /b> nuclear area of < /b> the < /b> head, the < /b> inference being that binding of < /b> DNA by the < /b> sperm is followed by internalisation [49, 50]. Int. J. ... to remove embryos from the < /b> female, to manipulate the < /b> embryos and finally to return the < /b> embryos to the < /b> rep...

Ngày tải lên: 03/11/2012, 10:01

16 507 1
Tài liệu Báo cáo Y học: Insights into the reaction mechanism of Escherichia coli agmatinase by site-directed mutagenesis and molecular modelling ppt

Tài liệu Báo cáo Y học: Insights into the reaction mechanism of Escherichia coli agmatinase by site-directed mutagenesis and molecular modelling ppt

... 5¢-AT TAATGGCATGCTTTACCCGT -3< /b> .UsingthePCR products of < /b> agmatinase with the < /b> GfiAandC T substi- tutions in < /b> the < /b> coding and noncoding strands, respectively, and using the < /b> 5¢ and 3< /b> primers mentioned above, ... with the < /b> same region of < /b> the < /b> arginases (Fig. 4). Since the < /b> arginase loop contains residues that interacts with...

Ngày tải lên: 21/02/2014, 01:21

5 475 0
Tài liệu Báo cáo Y học: Studies on the nonmevalonate pathway of terpene biosynthesis The role of 2C-methyl-D -erythritol 2,4-cyclodiphosphate in plants docx

Tài liệu Báo cáo Y học: Studies on the nonmevalonate pathway of terpene biosynthesis The role of 2C-methyl-D -erythritol 2,4-cyclodiphosphate in plants docx

... representation for the < /b> positioning of < /b> the < /b> substrate in < /b> the < /b> active site of < /b> IPP isomerase; (a) and (b) represent alternative paths for proton abstraction from the < /b> substrate by the < /b> ambident carboxylate ... exchange of < /b> the < /b> H A -hydrogen of < /b> IPP. In < /b> both cases, scrambling of < /b> the < /b> label takes place wi...

Ngày tải lên: 22/02/2014, 07:20

9 573 0
Báo cáo y học: "Antibodies against the CB10 fragment of type II collagen in rheumatoid arthritis" pdf

Báo cáo y học: "Antibodies against the CB10 fragment of type II collagen in rheumatoid arthritis" pdf

... compared with those using intact CII. Antibodies against CB10 were found in < /b> as many as 88% of < /b> 96 patients with long-standing RA, but only 12% of < /b> 33< /b> patients with PsA, 6% of < /b> 34< /b> patients with OA and 3%< /b> of < /b> ... Worthington J, Brass A, Morgan K: Identification of < /b> antibody epitopes within the < /b> CB-11 peptide of < /b> type II colla...

Ngày tải lên: 09/08/2014, 01:23

7 443 0
Báo cáo y học: "Longitudinal evaluation the pulmonary function of the pre and postoperative periods in the coronary artery bypass graft surgery of patients treated with a physiotherapy protocol" ppt

Báo cáo y học: "Longitudinal evaluation the pulmonary function of the pre and postoperative periods in the coronary artery bypass graft surgery of patients treated with a physiotherapy protocol" ppt

... [12] and the < /b> position of < /b> the < /b> drains [ 13]< /b> . Pain due to thoracotomy is a limiting factor for mobi- lity and breathing. A high level of < /b> postoperative pain is common because of < /b> the < /b> cutting of < /b> the < /b> skin, ... incentive spirometry, should be continued in < /b> the < /b> postoperative period. Limitations of < /b> the < /b> study T...

Ngày tải lên: 10/08/2014, 09:21

6 471 0
Báo cáo y học: "Requirements for the selective degradation of CD4 receptor molecules by the human immunodeficiency virus type 1 Vpu protein in the endoplasmic reticulum" doc

Báo cáo y học: "Requirements for the selective degradation of CD4 receptor molecules by the human immunodeficiency virus type 1 Vpu protein in the endoplasmic reticulum" doc

... eval- uated by quantitation of < /b> the < /b> signal detected in < /b> the < /b> area delin- eated on the < /b> autoradiogram relative to total CD4 as determined by quantitation of < /b> the < /b> band detected with the < /b> anti-CD4 antibodies ... [34< /b> ]. They found that Vpu-mediated pro- teolysis of < /b> CD4 involved dislocation of < /b> ubiquitinated intermediates in <...

Ngày tải lên: 13/08/2014, 05:22

15 389 0
Báo cáo y học: "ahead at the potential benefits of biotechnology-derived allergen therapeutics" potx

Báo cáo y học: "ahead at the potential benefits of biotechnology-derived allergen therapeutics" potx

... further increase the < /b> safety and utility of < /b> SIT. Biotechnology has the < /b> potential for the < /b> development of < /b> novel drugs for the < /b> treatment of < /b> allergies that may have several attributes that are distinct ... only treatment that attends to the < /b> root cause, rather than the < /b> clinical symp- toms, of < /b> allergic reactions. The < /b> most...

Ngày tải lên: 13/08/2014, 13:22

4 242 0
Báo cáo y học: "GE Rotterdam, the Netherlands. †Department of Human Genetic" pptx

Báo cáo y học: "GE Rotterdam, the Netherlands. †Department of Human Genetic" pptx

... due to edits by the < /b> community will be reported. Terms that represent concepts but are not recognized by the < /b> indexer can be added to the < /b> terminology system by selecting the < /b> terms in < /b> the < /b> text, starting ... asso- ciative concept combination to a natural community of < /b> inter- est, namely to that group of < /b> authors that share most of < /b> the...

Ngày tải lên: 14/08/2014, 08:21

15 270 0
Từ khóa:
w