Báo cáo y học: "Susceptibilities of medaka (Oryzias latipes) cell lines to a betanodavirus" docx

Báo cáo y học: "Susceptibilities of medaka (Oryzias latipes) cell lines to a betanodavirus" docx

Báo cáo y học: "Susceptibilities of medaka (Oryzias latipes) cell lines to a betanodavirus" docx

... properly cited. Research Susceptibilities of medaka ( Oryzias latipes ) cell lines to a betanodavirus Kei Adachi, Kosuke Sumiyoshi, Ryo Ariyasu, Kasumi Yamashita, Kosuke Zenke and Yasushi Okinaka* Abstract Background: ... Protocols Wiley-Blackwell, Iowa. 2009. 20. Taniguchi Y, Takeda S, Furutani-Seiki M, Kamei Y, Todo T, Sasado T, Deguchi T, Kondoh H, Mudde J, Yamazoe M, Hidaka...

Ngày tải lên: 12/08/2014, 04:20

7 199 0
Báo cáo y học: " Precision of field triage in patients brought to a trauma centre after introducing trauma team activation guidelines" pdf

Báo cáo y học: " Precision of field triage in patients brought to a trauma centre after introducing trauma team activation guidelines" pdf

... Steen PA: Assessing quality of care in a trauma referral center: benchmarking performance by TRISS-based statistics or by analysis of stratified ISS data? Journal of Trauma-Injury Infection & ... Mechanism of Injury Table 4: Usage and performance of TTA criteria by category of prehospital care provider Paramedic Anaesthetist TTA criteria Total Correct triage Overtriage Total...

Ngày tải lên: 13/08/2014, 23:20

10 334 0
Báo cáo Y học: Repression of FasL expression by retinoic acid involves a novel mechanism of inhibition of transactivation function of the nuclear factors of activated T-cells pptx

Báo cáo Y học: Repression of FasL expression by retinoic acid involves a novel mechanism of inhibition of transactivation function of the nuclear factors of activated T-cells pptx

... assay of binding specificity of plant lectins to yeast cells by biotin-avidin system and its application to the classification of yeast cells. Anal. Biochem. 254, 41–48. 31. Na, S .Y. , Kang, B .Y. , ... substrate 4-methyl-lum- bellifery-b-galactoside, and was normalize d for protein content [30]. A one-way analysis of variance was performed using GraphPad INSTAT Ò (GraphPad Softw...

Ngày tải lên: 24/03/2014, 03:21

9 481 0
Báo cáo Y học: Fusion of farnesyldiphosphate synthase and epi-aristolochene synthase, a sesquiterpene cyclase involved in capsidiol biosynthesis in Nicotiana tabacum docx

Báo cáo Y học: Fusion of farnesyldiphosphate synthase and epi-aristolochene synthase, a sesquiterpene cyclase involved in capsidiol biosynthesis in Nicotiana tabacum docx

... catalytic efficiency than the correspond- ing mixture of single enzymes. Some examples are D -hydantoinase/N-carbamylase [7], b-galactosidase/galac- tokinase [8], citrate synthase/malate dehydrogenase ... C-terminal P3 5¢-TAGAG CCATGGCCTCAGCAGCAGTT¢-3¢ eAS N-terminal P4 5¢-CTACTCGAGTCAAATTTTGATGGAGTC-3¢ eAS C-terminal P5 5¢-TA GGATCCCTTTTGCCTCTTGTAAAT-3¢ FPPS C-terminal P6 5¢-AT GGATCCGGAATG...

Ngày tải lên: 24/03/2014, 03:21

8 410 0
Báo cáo Y học: Expression of recombinant murine pregnancy-associated plasma protein-A (PAPP-A) and a novel variant (PAPP-Ai) with differential proteolytic activity pot

Báo cáo Y học: Expression of recombinant murine pregnancy-associated plasma protein-A (PAPP-A) and a novel variant (PAPP-Ai) with differential proteolytic activity pot

... PAPP -A, PAPP-Ai is much less proteolytically active against IGFBP-4. As measured after 180 min of incubation, the activity of PAPP-Ai is only about 10% of the activity of PAPP -A (Fig. 4A) . A ... pregnancy-associated plasma protein -A (PAPP -A) cDNA encoding a 1545 amino-acid protein has been cloned. We have also identified and cloned cDNA that encodes a novel variant of P...

Ngày tải lên: 31/03/2014, 21:21

10 426 0
Báo cáo y học: "Growth of Microorganisms in Total Parenteral Nutrition Solutions Containing Lipi" docx

Báo cáo y học: "Growth of Microorganisms in Total Parenteral Nutrition Solutions Containing Lipi" docx

... Con- taining Lipid Takashi Kuwahara 1  , Kazuyuki Shimono 1 , Shinya Kaneda 1 , Takumi Tamura 1 , Masao Ichihara 2 , Yoshifumi Nakashima 1 1. Preclinical Assessment Department, Otsuka Pharmaceutical ... Pharmaceutical Factory, Inc., Tokushima, Japan. 2. Research and Development Center, Otsuka Pharmaceutical Factory, Inc., Tokushima, Japan.  Corresponding author: Takashi Kuwahara, Ph....

Ngày tải lên: 08/08/2014, 18:20

9 450 0
Báo cáo y học: "Role of Genetic Polymorphisms in Therapeutic Response to Anti-Asthma Therapy" pot

Báo cáo y học: "Role of Genetic Polymorphisms in Therapeutic Response to Anti-Asthma Therapy" pot

... M, Bazan-Socha S, Szczeklik A. Enhanced expression of leukotriene C4 synthase due to overactive transcrip- tion of an allelic variant associated with aspirin-intolerant asthma Am J Respir Cell ... one, as once understood, we may be able to rely on a patient’s genetics to aid in choosing the most appropriate therapy. As clinicians attempting to stay current in the evolving sci...

Ngày tải lên: 08/08/2014, 21:20

3 387 0
Báo cáo y học: "Treatment of Hereditary Angioedema: items that need to be addressed in practice parameter" ppt

Báo cáo y học: "Treatment of Hereditary Angioedema: items that need to be addressed in practice parameter" ppt

... to be addressed in practice parameter Callie Dagen 1 and Timothy J Craig* 2 Abstract Background: Hereditary Angioedema (HAE) is a rare, autosomal dominant (AD) disorder caused by a C1 esterase ... percentage of individuals with HAE who are able to predict an HAE attack based on prodromal symptoms based on the study by Prematta in 2009. 6.5% of patient are able to predict the o...

Ngày tải lên: 08/08/2014, 21:20

7 441 0
Báo cáo y học: " Reconstitution of the adult B cell repertoire after treatment with rituximab" pptx

Báo cáo y học: " Reconstitution of the adult B cell repertoire after treatment with rituximab" pptx

... breakdown of B cell tolerance for autoantigens may be at the core of the pathogenesis of SLE and RA and perhaps of other autoimmune diseases. As is always the case with disease, the ultimate goal ... still bear a large load of autoreactive B cells in the mature compartment, it will also be important to achieve a phenotypic and functional definition of anergy to elucidate...

Ngày tải lên: 09/08/2014, 07:20

2 231 0
Báo cáo y học: " Impairment of chondrocyte biosynthetic activity by exposure to 3-tesla high-field magnetic resonance imaging is temporar" pptx

Báo cáo y học: " Impairment of chondrocyte biosynthetic activity by exposure to 3-tesla high-field magnetic resonance imaging is temporar" pptx

... runx2/cbfa1 (270 bp), 5'-CCCCACGACAACCGCAC- CAT-3' (forward) and 5'-CACTCCGGCCCACAAATC-3' (reverse) [25]; IL-1β (394 bp), 5'-AAA CAG ATG AAG AGC TGC ATC CAA-3' (forward) ... per 100 mg of cartilage) was always kept con- stant [13,14]. The other part of the cartilage samples was used for mRNA isolation, alkaline phosphatase assays, and cell death assays; to...

Ngày tải lên: 09/08/2014, 08:22

11 419 0
Từ khóa:
w