Báo cáo y học: " A novel trifunctional IgG-like bispecific antibody to inhibit HIV-1 infection and enhance lysis of HIV by targeting activation of complement" ppsx
... antibody to inhibit HIV- 1 infection and enhance lysis of HIV by targeting activation of complement Leili Jia †1 , Yuanyong Xu †1 , Chuanfu Zhang †1 , Yong Wang †1 , Huihui Chong †2 , Shaofu Qiu †1 , ... bispecific antibody to inhibit HIV- 1 infection and enhance lysis of HIV by targeting activation of complement Virology Journal 20...
Ngày tải lên: 12/08/2014, 04:20
... sequences of the related apicomplexa parasites Plasmodium falciparum and Plasmodium yoelii,aswellasin those of Arabidopsis thaliana, Drosophila melanogaster, Caenorhabditis elegans and Homo sapiens. ... into pBluescript-SK+ and sequenced using an ALFexpress automated sequencer (Amersham Pharmacia Biotech). Rapid amplification of cDNA ends (RACE) and sequencing To obtain full-le...
Ngày tải lên: 08/03/2014, 22:20
... 5’-AAGGAGGCACTGGGAGAGGGGAAAT-3’ (bases -1323 to -1299) and antisense, 5’- CCCCACCAAGCCAACACAGGATGGA -3’ (bases -919 to- 895) were used to amplify a 429-bp product from genomic DNA (Fig. 1A) . ... samples, and Ms. H. Tobe, M. Nakamura, and K. Sugama for their technical as- sistance. This work was supported financially by a grant from the Ministry of Education, Science...
Ngày tải lên: 26/10/2012, 10:04
Tài liệu Báo cáo Y học: A novel meta-cleavage dioxygenase that cleaves a carboxyl-groupsubstituted 2-aminophenol Purification and characterization of 4-amino-3-hydroxybenzoate 2,3-dioxygenase from Bordetella sp. strain 10d doc
... 6-amino-m-cresol and 2,5- pyridinedicarboxylic acid were purchased from Tokyo Kasei Kogyo (Tokyo, Japan), meat extract (Extract Ehlrich) was from Kyokuto Seiyaku Kogyo (Osaka, Japan) and 4-aminoresorcinol hydrochloride ... signifi- cant levels of identity to sequences of other proteins including those of extradiol dioxygenases available in the FASTA AND BLAST database programs at...
Ngày tải lên: 21/02/2014, 01:21
Tài liệu Báo cáo Y học: A novel, inducible, citral lyase purified from spores of Penicillium digitatum docx
... [18]. For the enzymatic equivalent of this reaction the actions of a hydratase and an aldolase are needed. Citral lyase of P. digitatum combines hydratase and aldolase activity in a single enzyme. No ... and average spore size did not change during induction. Stability of citral lyase activity The activity and stability of citral lyase was dramatically affected by the...
Ngày tải lên: 21/02/2014, 01:21
Báo cáo Y học: A novel gain-of-function mutation of the integrin a2 VWFA domain docx
... are underlined): for E318 to W, 5¢-TTCAATGTGTCTGATTGGGCAGCTCTACTAGA AAAGGCTG-3¢; for E318 to I, 5¢-CAATGTGTCTGA TATAGCAGCTCTACTAGAAAAG-3¢; for E318 to R, 5¢-CAATGTGTCTGATCGAGCAGCTCTACTAGAAA AG-3¢; ... : a case con trol study. Lancet 353, 351–353. 20. Matsubara, Y. , Mur ata, M., Maruyama, T., Handa, M., Yamagata, N ., Watanabe, G ., Saruta, T. & Ikeda, Y. (2000) Association betw...
Ngày tải lên: 08/03/2014, 22:20
Báo cáo y học: " A Novel Population of Mesenchymal Progenitors with Hematopoietic Potential Originated from CD14- Peripheral Blood Mononuclear Cell" potx
... src="data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAA94AAAWQCAIAAAAjjQtaAAAACXBIWXMAABYlAAAWJQFJUiTwAAAYCUlEQVR42uzYMRUAIAxDQcqMTVzhNV3w0OVOQqb/Uue+BQAATNsmAAAAaQ4AAHyVxAoAADDOaw4AANIcAACQ5gAAIM0BAABpDgAA0hwAAJDmAAAgzQEAAGkOAADSHAAAkOYAACDNAQAAaQ4AANIcAACQ5gAAIM0BAABpDgAA0hwAAJDmAAAgzQEAAGkOAADSHAAAkOYAACDNAQAAaQ4AANIcAACQ5gAAIM0BAABpDgAA0hwAAJDmAAAgzQEAAGkOAABIcwAAkOYAAIA0BwAAaQ4AAEhzAACQ5gAA...
Ngày tải lên: 08/08/2014, 18:20
Báo cáo y học: "γ A novel mechanism for the regulation of IFN-γ inducible protein-10 expression in rheumatoid arthritis" ppsx
... transillumination. Statistical analysis Data were analyzed on a Power Macintosh computer using a statistical software package (Statview 4.5; Abacus Concept Inc, Berkeley, CA, USA) and expressed as mean ±SEM. ... 83:1174- 1178. 19. Kasama T, Shiozawa F, Kobayashi K, Yajima N, Hanyuda M, Takeuchi TT, Mori Y, Negishi M, Ide H, Adachi M: Vascular endothelial growth factor expression by a...
Ngày tải lên: 09/08/2014, 01:21
Báo cáo y học: "A novel approach to measure the contribution of matrix metalloproteinase in the overall net proteolytic activity present in synovial fluids of patients with arthritis" pptx
... Yoshihara Y, Nakamura H, Obata K, Yamada H, Hayakawa T, Fujikawa K, Okada Y: Matrix metalloproteinases and tissue inhibitors of metalloproteinases in synovial fluids from patients with rheumatoid ... gelatinolytic activity was measured in arbi- trary units by quantitative analysis of a negatively stained band using computerized image analysis (Image Quant 5.0; Molec- ular Dynamics...
Ngày tải lên: 09/08/2014, 08:22
Báo cáo y học: "A novel informatics concept for high-throughput shotgun lipidomics based on the molecular fragmentation query language" ppt
... lipid masses Yes Yes Yes Yes Yes Yes Database of spectra Yes Database expandability Yes Yes Yes Yes Yes Isotopic correction Yes Yes Yes Yes Cross-platform Yes Yes Yes Yes Yes Yes Yes Spectra alignment ... LipidXplorer takes full advantage of the high mass resolution and mass accuracy of a hybrid tandem mass spectrometer. It has also become apparent that averaging and alignment of...
Ngày tải lên: 09/08/2014, 22:23