Báo cáo y học: " High Human T Cell Leukemia Virus Type-1(HTLV-1) Provirus Load in Patients with HTLV-1 Carriers Complicated with HTLV-1-unrelated disorders" docx

Báo cáo y học: " High Human T Cell Leukemia Virus Type-1(HTLV-1) Provirus Load in Patients with HTLV-1 Carriers Complicated with HTLV-1-unrelated disorders" docx

Báo cáo y học: " High Human T Cell Leukemia Virus Type-1(HTLV-1) Provirus Load in Patients with HTLV-1 Carriers Complicated with HTLV-1-unrelated disorders" docx

... 10.1186/1743-422X-7-81 Cite this article as: Sasaki et al., High Human T Cell Leukemia Virus Type- 1 (HTLV-1) Provirus Load in Patients with HTLV-1 Carriers Complicated with HTLV-1- unrelated disorders Virology Journal ... of HAM patients, while the VL was at most 10 to 20% in general. On the other hand, patients co-infected with Table 1: The distribution...

Ngày tải lên: 12/08/2014, 04:20

7 272 0
Báo cáo y học: "Allergen-specific T cell quantity in blood is higher in allergic compared to nonallergic individuals" pptx

Báo cáo y học: "Allergen-specific T cell quantity in blood is higher in allergic compared to nonallergic individuals" pptx

... IgE than allergen-specific B cells. The third important finding of the study is the simi- larity in allergen -specific Th cell quantity when analyzed at different time-points. This suggests that ... Asymptomatic subjects (without symptom s of asthma, rhinitis or eczema) were recruited by advertising. They were included into the study as “nonallergic subjects” only if they were SPT-negativ...

Ngày tải lên: 08/08/2014, 21:20

12 334 0
Báo cáo y học: "Characteristics of T-cell large granular lymphocyte proliferations associated with neutropenia and inflammatory arthropathy" ppt

Báo cáo y học: "Characteristics of T-cell large granular lymphocyte proliferations associated with neutropenia and inflammatory arthropathy" ppt

... patients, with and without arthritis. Further studies involving patients with RA and T- LGL proliferations may provide important data for a better under- standing of RA pathogenesis. Competing interests The ... marrow with increased granulocyte precur- sor count and left-shifted maturation, but no antyneutrophil antibodies were present. The majority of our patients with T- LGL...

Ngày tải lên: 09/08/2014, 10:23

12 565 0
Báo cáo y học: "Collagen-specific T-cell repertoire in blood and synovial fluid varies with disease activity in early rheumatoid arthritis" pot

Báo cáo y học: "Collagen-specific T-cell repertoire in blood and synovial fluid varies with disease activity in early rheumatoid arthritis" pot

... AGGCTCATCCATTATTCAAATAC BV14 GGGCTGGGCTTAAGGCAGATCTAC BV15 CAGGCACAGGCTAAATTCTCCCTG BV16 GCCTGCAGAACTGGAGGATTCTGG BV17 TCCTCTCACTGTGACATCGGCCCA BV18 CTGCTGAATTTCCCAAAGAGGGCC BV19 TCCTCTCACTGTGACATCGGCCCA BV20 TGCCCCAGAATCTCTCAGCCTCCA BV21 ... properly cited. Abstract Introduction Type II collagen is a DR4/DR1 restricted target of self-reactive T cells that sustain rheumatoid arthritis. The...

Ngày tải lên: 09/08/2014, 13:22

18 340 0
Báo cáo y học: " Depletion of T-cell intracellular antigen proteins promotes cell proliferation" potx

Báo cáo y học: " Depletion of T-cell intracellular antigen proteins promotes cell proliferation" potx

... ribonucleoproteins [5]. Consistently, both TIA proteins directly bind to RNA as well as to single- and double-stranded DNA [3-5]. It is tempting to speculate that TIA proteins could also interact with ... therefore, they could interact with basal transcription machinery and influence its activity. In addition, both pro- teins contain three RNA-binding motifs and are structurally close t...

Ngày tải lên: 09/08/2014, 20:20

14 339 0
Báo cáo y học: " Eosinophil and T cell markers predict functional decline in COPD patients" ppsx

Báo cáo y học: " Eosinophil and T cell markers predict functional decline in COPD patients" ppsx

... recurrent infection with this com- mon pathogen in patients with COPD[24,25]. In addition to viruses, cytotoxic lymphocyte responses, which are coordinated by CD4+ cells, exert an important role in defending ... COPD patients have a defect in their ability to phagocytose apop- totic cells in the lung[37]. Conversely, it is conceivable that IL-2 protects the lung by actually...

Ngày tải lên: 12/08/2014, 14:20

13 255 0
Báo cáo y học: " Abnormalities of T cell signaling in systemic lupus erythematosus" pdf

Báo cáo y học: " Abnormalities of T cell signaling in systemic lupus erythematosus" pdf

... Ding XZ, Dennis GJ, Tsokos GC: Altered pattern of TCR/CD3- mediated protein-tyrosyl phosphorylation in T cells from patients with systemic lupus erythematosus. De cient expression of the T cell ... Delaney N, Tsokos GC: Reconstitution of de cient T cell receptor zeta chain restores T cell signaling and augments T cell receptor/CD3-induced interleukin-2 production...

Ngày tải lên: 12/08/2014, 15:22

10 347 0
Báo cáo y học: "High resolution discovery and confirmation of copy number variants in 90 Yoruba Nigerians" pdf

Báo cáo y học: "High resolution discovery and confirmation of copy number variants in 90 Yoruba Nigerians" pdf

... containing 0.005% Trition X-100 for 30 minutes at 42°C with rotation set at 15 rpm. The arrays were rinsed and filled with Wash buffer A (Affymetrix). Staining with streptavidin, R-phyco- erythrin ... seg- mentation results shown in Figure 2 illustrate the reduction in noise on the typing array. In addition to the triplicate probes, the CNV-typing array has improved sensitivity fo...

Ngày tải lên: 09/08/2014, 20:20

18 440 0
Báo cáo y học: " Inflammatory cytokines, goblet cell hyperplasia and altered lung mechanics in Lgl1+/- mice" pptx

Báo cáo y học: " Inflammatory cytokines, goblet cell hyperplasia and altered lung mechanics in Lgl1+/- mice" pptx

... tempting to speculate that latent effects on elastin integrity may increase vulnerability of Lgl1 +/- mice to respiratory insult at maturity and that Lgl1 haploinsufficiency may modify risk to ... significant at this time. To determine whether elevated cytokine levels were associated with induction of recruitment of inflam- matory cells, BAL cell differentials were determined at PN10 and...

Ngày tải lên: 12/08/2014, 14:20

15 302 0
Báo cáo y học: " Lymphocyte Responses to Chymotrypsin- or Trypsin VDigested b-Lactoglobulin in Patients with Cow’s Milk Allergy" doc

Báo cáo y học: " Lymphocyte Responses to Chymotrypsin- or Trypsin VDigested b-Lactoglobulin in Patients with Cow’s Milk Allergy" doc

... induced in supernatants with intact BLG stimulation from all patients tested. IFN-c production by stimulation with the chymo- trypsin-digested peptides was less than with intact BLG but was still at ... chymotrypsin- digested BLG peptides was much lower than that with intact BLG in PBMCs from all patients except for patient 8. The SI with chymotrypsin-digested peptides in...

Ngày tải lên: 08/08/2014, 21:20

9 455 0
Từ khóa:
w