Báo cáo y học: " High Human T Cell Leukemia Virus Type-1(HTLV-1) Provirus Load in Patients with HTLV-1 Carriers Complicated with HTLV-1-unrelated disorders" docx
Báo cáo y học: " High Human T Cell Leukemia Virus Type-1(HTLV-1) Provirus Load in Patients with HTLV-1 Carriers Complicated with HTLV-1-unrelated disorders" docx
... 10.1186/1743-422X-7-81
Cite this article as: Sasaki et al., High Human T Cell Leukemia Virus Type-
1 (HTLV-1) Provirus Load in Patients with HTLV-1 Carriers Complicated with
HTLV-1- unrelated disorders Virology Journal ... of
HAM patients, while the VL was at most 10 to 20% in
general. On the other hand, patients co-infected with
Table 1: The distribution...
Báo cáo y học: "Allergen-specific T cell quantity in blood is higher in allergic compared to nonallergic individuals" pptx
... IgE than
allergen-specific B cells.
The third important finding of the study is the simi-
larity in allergen -specific Th cell quantity when analyzed
at different time-points. This suggests that ... Asymptomatic subjects (without
symptom s of asthma, rhinitis or eczema) were recruited
by advertising. They were included into the study as
“nonallergic subjects” only if they were SPT-negativ...
Báo cáo y học: "Characteristics of T-cell large granular lymphocyte proliferations associated with neutropenia and inflammatory arthropathy" ppt
... patients, with and without
arthritis. Further studies involving patients with RA and T- LGL
proliferations may provide important data for a better under-
standing of RA pathogenesis.
Competing interests
The ... marrow with increased granulocyte precur-
sor count and left-shifted maturation, but no antyneutrophil
antibodies were present. The majority of our patients with T-
LGL...
Báo cáo y học: "Collagen-specific T-cell repertoire in blood and synovial fluid varies with disease activity in early rheumatoid arthritis" pot
... AGGCTCATCCATTATTCAAATAC
BV14 GGGCTGGGCTTAAGGCAGATCTAC
BV15 CAGGCACAGGCTAAATTCTCCCTG
BV16 GCCTGCAGAACTGGAGGATTCTGG
BV17 TCCTCTCACTGTGACATCGGCCCA
BV18 CTGCTGAATTTCCCAAAGAGGGCC
BV19 TCCTCTCACTGTGACATCGGCCCA
BV20 TGCCCCAGAATCTCTCAGCCTCCA
BV21 ... properly cited.
Abstract
Introduction Type II collagen is a DR4/DR1 restricted target of
self-reactive T cells that sustain rheumatoid arthritis. The...
Báo cáo y học: " Depletion of T-cell intracellular antigen proteins promotes cell proliferation" potx
... ribonucleoproteins [5]. Consistently,
both TIA proteins directly bind to RNA as well as to single-
and double-stranded DNA [3-5]. It is tempting to speculate
that TIA proteins could also interact with ... therefore, they could interact with basal transcription
machinery and influence its activity. In addition, both pro-
teins contain three RNA-binding motifs and are structurally
close t...
Báo cáo y học: " Eosinophil and T cell markers predict functional decline in COPD patients" ppsx
... recurrent infection with this com-
mon pathogen in patients with COPD[24,25]. In addition
to viruses, cytotoxic lymphocyte responses, which are
coordinated by CD4+ cells, exert an important role in
defending ... COPD
patients have a defect in their ability to phagocytose apop-
totic cells in the lung[37]. Conversely, it is conceivable
that IL-2 protects the lung by actually...
Báo cáo y học: " Abnormalities of T cell signaling in systemic lupus erythematosus" pdf
... Ding XZ, Dennis GJ, Tsokos GC: Altered pattern of TCR/CD3-
mediated protein-tyrosyl phosphorylation in T cells from patients with
systemic lupus erythematosus. De cient expression of the T cell ... Delaney N, Tsokos
GC: Reconstitution of de cient T cell receptor zeta chain restores T cell
signaling and augments T cell receptor/CD3-induced interleukin-2
production...
Báo cáo y học: "High resolution discovery and confirmation of copy number variants in 90 Yoruba Nigerians" pdf
... containing
0.005% Trition X-100 for 30 minutes at 42°C with rotation
set at 15 rpm. The arrays were rinsed and filled with Wash
buffer A (Affymetrix). Staining with streptavidin, R-phyco-
erythrin ... seg-
mentation results shown in Figure 2 illustrate the reduction
in noise on the typing array. In addition to the triplicate
probes, the CNV-typing array has improved sensitivity fo...
Báo cáo y học: " Inflammatory cytokines, goblet cell hyperplasia and altered lung mechanics in Lgl1+/- mice" pptx
... tempting to speculate that latent
effects on elastin integrity may increase vulnerability of
Lgl1
+/-
mice to respiratory insult at maturity and that Lgl1
haploinsufficiency may modify risk to ... significant at
this time. To determine whether elevated cytokine levels
were associated with induction of recruitment of inflam-
matory cells, BAL cell differentials were determined at
PN10 and...
Báo cáo y học: " Lymphocyte Responses to Chymotrypsin- or Trypsin VDigested b-Lactoglobulin in Patients with Cow’s Milk Allergy" doc
... induced in
supernatants with intact BLG stimulation from all patients
tested. IFN-c production by stimulation with the chymo-
trypsin-digested peptides was less than with intact BLG but
was still at ... chymotrypsin-
digested BLG peptides was much lower than that with
intact BLG in PBMCs from all patients except for patient 8.
The SI with chymotrypsin-digested peptides in...
Từ khóa: