Báo cáo y học: " Characterization and frequency of a newly identified HIV-1 BF1 intersubtype circulating recombinant form in São Paulo, Brazil" ppt

Báo cáo y học: " Characterization and frequency of a newly identified HIV-1 BF1 intersubtype circulating recombinant form in São Paulo, Brazil" ppt

Báo cáo y học: " Characterization and frequency of a newly identified HIV-1 BF1 intersubtype circulating recombinant form in São Paulo, Brazil" ppt

... 270:988-991. doi:10.1186/1743-422X-7-74 Cite this article as: Sanabani et al.: Characterization and frequency of a newly identified HIV-1 BF1 intersubtype circulating recombinant form in São Paulo, Brazil. Virology Journal 2010 7:74. Submit ... frequency of a newly identified HIV-1 BF1 intersubtype circulating recombinant form in São...

Ngày tải lên: 12/08/2014, 04:20

12 301 0
Tài liệu Báo cáo Y học: Characterization and regulation of yeast Ca2+-dependent phosphatidylethanolamine-phospholipase D activity docx

Tài liệu Báo cáo Y học: Characterization and regulation of yeast Ca2+-dependent phosphatidylethanolamine-phospholipase D activity docx

... amino acid- rich media included: YPD [yeast extract and Bactopeptone (YP) containing 2% dextrose]; YPA (YP containing 0.05% glucose and 2% potassium acetate); and YPG (YP containing 3.5% galactose). Phospholipase ... phosphatidylserine and does not catalyse a transphosphatidylation with primary short-chain alcohols. We have characterized the cytosolic and mem- brane-bound forms o...

Ngày tải lên: 22/02/2014, 07:20

10 499 0
Báo cáo y học: "Characterization and modeling of the Haemophilus influenzae core and supragenomes based on the complete genomic sequences of Rd and 12 clinical nontypeable strain" potx

Báo cáo y học: "Characterization and modeling of the Haemophilus influenzae core and supragenomes based on the complete genomic sequences of Rd and 12 clinical nontypeable strain" potx

... valuable discussions and data check- ing; Alice Erwin and Arnold Smith of the Seattle Biomedical Research Insti- tute and Maynard V Olson, Rajinder K Kaul and Yang Zhou of the University of Washington ... shared genes that are unique to that pair of strains. A typical pair of strains differs by 395 genes. Similar pairs of strains are shaded in yellow, while divergent...

Ngày tải lên: 14/08/2014, 07:21

18 508 0
Báo cáo khoa học: Characterization and regulation of a bacterial sugar phosphatase of the haloalkanoate dehalogenase ppt

Báo cáo khoa học: Characterization and regulation of a bacterial sugar phosphatase of the haloalkanoate dehalogenase ppt

... CTGCTGTAATAATGGGTAGAAGG ARA439 GGAATTC CATATGCGTATTATGGCCAG ARA440 TATTTA CTCGAGAATCCCCTCCTCAGC ARA444 CG GGATCCACCGTGAAAAAGAAAGAATTGTC ARA451 GAATTCATAAAG AAGCTTTGTCTGAAGC ARA456 CGGCGCGT CATATGGCCAGTCATGATA ARA457 ... ATG ACT GG ARA514 TAATACGCATTTGCTC CGT GTT TTC GTC ATA AAA TAA AAC GCT TTC AAA TAC ARA515 GTATTTGAAAGCGTTTTATTTTATGACGAA AAC ACG GAG CAA ATG CGT ATT A L. M. Godinho and I....

Ngày tải lên: 14/03/2014, 23:20

14 594 0
Báo cáo y học: "Costs and effects of paliperidone extended release compared with alternative oral antipsychotic agents in patients with schizophrenia in Greece: A cost effectiveness study" pdf

Báo cáo y học: "Costs and effects of paliperidone extended release compared with alternative oral antipsychotic agents in patients with schizophrenia in Greece: A cost effectiveness study" pdf

... therapeutic area of schizophrenia is vast and growing rapidly, and was helpful in developing a solid and definitive model. Information that was not available in the literature was obtained from clinical expert ... stable day in the case of -10% of frequency of relapses and €2.42 per stable day in the case of -10% of the duration of relapses), even in the ev...

Ngày tải lên: 08/08/2014, 23:21

12 479 0
Báo cáo y học: "Costs and effects of paliperidone extended release compared with alternative oral antipsychotic agents in patients with schizophrenia in Greece: a cost effectiveness study" ppsx

Báo cáo y học: "Costs and effects of paliperidone extended release compared with alternative oral antipsychotic agents in patients with schizophrenia in Greece: a cost effectiveness study" ppsx

... schizophrenia in Greece: a cost effectiveness study. Annals of General Psychiatry 2008, 7:16. Table 1: Mean annual number of stable days and cost per patient by pharmaceutical treatment. Paliperidone ... Kousoulakou H, Ollandezos M, Athanasakis K, Papanico- laou S, Kyriopoulos I: Costs and effects of paliperidone extended release compared with alternative oral antipsy- chotic ag...

Ngày tải lên: 08/08/2014, 23:21

2 372 0
Báo cáo y học: " Safety and efficacy of a generic fixed-dose combination of stavudine, lamivudine and nevirapine antiretroviral therapy between HIV-infected patients with baseline CD4 " pot

Báo cáo y học: " Safety and efficacy of a generic fixed-dose combination of stavudine, lamivudine and nevirapine antiretroviral therapy between HIV-infected patients with baseline CD4 " pot

... Sirirat Likanonsakul 1 and Somnuek Sungkanuparph 2 Address: 1 Bamrasnaradura Infectious Diseases Institute, Ministry of Public Health, Nonthaburi, 11000, Thailand and 2 Faculty of Medicine Ramathibodi ... study and statistical analysis. SC participated in the design of the study. SL par- ticipated in the design of the study. SS participated in the design of the stud...

Ngày tải lên: 10/08/2014, 05:20

8 371 0
Báo cáo y học: " Development and evaluation of a tool for the assessment of footwear characteristics" pdf

Báo cáo y học: " Development and evaluation of a tool for the assessment of footwear characteristics" pdf

... range of each measure across included footwear was also reported. Intra-rater and inter-rater reliability for all cate- gorical data was evaluated using percentage agreement, and kappa (κ) statistics ... mid- soles, lateral and medial midsole hardness items were combined for data analysis. Intra-rater and inter-rater reli- ability for all continuous data were evaluated using intra-...

Ngày tải lên: 10/08/2014, 21:23

12 379 0
Báo cáo y học: "Catheterization and embolization of a replaced left hepatic artery via the right gastric artery through the anastomosis: a case report" pdf

Báo cáo y học: "Catheterization and embolization of a replaced left hepatic artery via the right gastric artery through the anastomosis: a case report" pdf

... of extrahepatic arterial blood supply to the liver during hepatic arterial infusion chemotherapy. Eur Radiol 1998, 8:1613-1618. 3. Tanaka T, Arai Y, Inaba Y, Matsueda K, Aramaki T, Takeuchi Y, ... retrograde catheterization of the right gastric artery via the left gastric artery. J Vasc Interv Radiol 2001, 12:1103-1106. 9. Inaba Y, Arai Y, Matsueda K, Takeuchi Y, Aramaki T: Right ga...

Ngày tải lên: 10/08/2014, 23:22

4 291 1
Báo cáo y học: " Development and evaluation of an immunochromatographic strip test based on the recombinant UL51 protein for detecting antibody against duck enteritis virus" ppsx

Báo cáo y học: " Development and evaluation of an immunochromatographic strip test based on the recombinant UL51 protein for detecting antibody against duck enteritis virus" ppsx

... China (No.706050). Author details 1 Avian Diseases Research Center, College of Veterinary Medicine of Sichuan Agricultural University, Ya’an, Sichuan, 625014, China. 2 Key Laboratory of Animal ... (LB) agar medium containing 50 μg/mL kanamycin, and were incubated overnight at 37° C. 200 m L LB medium containing 50 μg/mL kanamycin was inoculated with a freshly grown colony containing...

Ngày tải lên: 12/08/2014, 01:22

8 349 0
Từ khóa:
w