Báo cáo y học: "Nucleolar localization of influenza A NS1: striking differences between mammalian and avian cells" pot
Báo cáo y học: "Nucleolar localization of influenza A NS1: striking differences between mammalian and avian cells" pot
... stained with a rabbit anti-NS1 polyclonal antibody and a mouse anti-NPM monoclonal antibody, revealed with a secondary FITC-labelled anti-rabbit antibody and a secondary RhodamineX-labelledanti-mouse ... Guérin1,2AbstractIn mammalian cells, nucleolar localization of influenza A NS1 requires the presence of a C-terminal nucleolar locali-zation signal. This nucleolar localization signal is present ... nucleolus of avian cells even in the absence of the above described C-terminal nucleolar localization signal. Thus, nucleolar localization of NS1 in avian cells appears to rely on a different nucleolar...
- 5
- 256
- 0
Báo cáo y học: "Conserved epitopes of influenza A virus inducing protective immunity and their prospects for universal vaccine development" doc
... to evadeadaptive immune response in a variety of mammalian and avian species, including humans. The unpre dictablevariability of influenza A viruses, which cause yearly epi-demics in human population, ... that eM2 i s a valid and versatile vaccine candidate to induce protectiveimmunity against any strain of human influenza A viruses, and give a promise for finding new “universal”vaccine against ... supertypes: a revised and update classification. BMC Immunol 2008, 9:1.120. Matsui M, Kohyama S, Suda T, Yokoyama S, Mori M, Kobayashi A, Taneichi M, Uchida T: A CTL-based liposomal vaccine capable...
- 13
- 325
- 0
Báo cáo y học: "Ocular Manifestations of Rickettsiosis: 1. Mediterranean Spotted Fever: laboratory analysis and case reports" potx
... Mediterranean and Black seas, in Kenya and other parts of central Africa, South Africa, and certain parts of India. MSF varies in severity but is seldom fatal. The incubation period is 5-7 days and ... in about 50% of cases. The duration of disease is 7-14 days. The clinical signs and symptoms include fever (up to 40°C), headache, chills, myalgias, arthralgias, malaise, and anorexia. Maculopapular ... The standard treatment for MSF is oral doxycyclyne (100 mg daily) for 10-14 days. Case reports Both cases described herein were observed on the island of Sardinia, Italy, an endemic area for...
- 2
- 331
- 0
Báo cáo y học: " Rapid isolation of mycoviral double-stranded RNA from Botrytis cinerea and Saccharomyces cerevisiae" pot
... to analyze a large number of fungal isolates it is necessary to have a rapid method that allows the isolation and partial charac-terizat ion of viral dsRNA us ing small amounts of myceliaor yeast ... analysis, and treated with enzymes for their partial characterization.ThemethodallowsgettinghighqualitydsRNA,freeofDNA and ssRNA, and it can be applied to isolatedsRNA from a ny type of fungus or any ... infect intact cells and aretransmitted vertically by intracellular routes (meiosis and mitosis) and horizontally by anastomosis of compatiblehyphae or through sexual mating of yea st cells. Mycov-iruses...
- 7
- 319
- 0
Báo cáo Y học: Immunohistochemical localization of guinea-pig leukotriene B4 12-hydroxydehydrogenase/15-ketoprostaglandin 13-reductase pdf
... Pharmaceutical Company(Osaka, Japan), and PGs were purchased from Cayman (AnnArbor, MI, USA). Nitrocellulose membrane was obtainedfrom Amersham (Cleveland, OH, USA). Silica gel 60 thin-layer ... PGE2[47]. PGE2acts as relaxant of airway smoothmuscle, and has protective roles in the airway againstinflammation [48]. Airway smooth muscle and epithelialcells also express LTA4hydrolase [7]. ... J. (1977) NADP-linked15-hydroxyprostaglandin dehydrogenase from human placenta:partial purification and characterization of the enzyme and identification of an inhibitor in placental tissue....
- 9
- 271
- 0
Báo cáo y học: "Extracellular localization of galectin-3 has a deleterious role in joint tissues" docx
... Base pairs ReferenceADAMTS-5 S: GGCATCATTCATGTGACACAS: GCATCGTAGGTCTGTCCTG364MMP-3 S: GAAAGTCTGGGAAGAGGTGACTCCACAS: CAGTGTTGGCTGAGTGAAAGAGACCC284Osteocalcin S: CATGAGAGCCCTCACAAS: AGAGCGACACCCTAGAC310 ... AGAGCGACACCCTAGAC310 [48]Alkaline phosphatase S: TGCAGTACGAGCTGAACAGAS: TGAAGACGTGGGAATGGTC267Type I collagen α1 chain S: CCGAAGGTTCCCCTGGACGAAS: CGCCCTGTTCGCCTGTCTCA25218S S: GAATCAGGGTTCGATTCCGAS: ... phases lead to hyperplasia of thesynovium, which may invade the joint space and adhere to car-tilage, generating a pannus. This pannus is composed of veryactive cells such as leukocytes and, ...
- 9
- 351
- 0
Báo cáo y học: "Immunohistochemical localization of mu opioid receptor in the marginal division with comparison to patches in the neostriatum of the rat brain" docx
... plays key roles in analgesia and also has effects onlearning and memory. The presence of both enkephalinandMORintheMrDsuggeststhatMORmightplayarole in the learning and memory f unctions of ... moonshape band that parallels with the subcallosal streak. C: At thecaudomedial portion of the St, MOR-immunoreactivity was seendensely stained in the band of nerve fibers that arranged in parallelsin ... on lysates of therat MrD and also on the Hippocampal tissue using a polyclonal antiserum against a peptide mapping at the Cterminus of MOR. The results revealed an immunoreac-tive band of about...
- 9
- 370
- 0
Báo cáo y học: "Co-localization of CENP-C and CENP-H to discontinuous domains of CENP-A chromatin at human neocentromeres" ppsx
... Oligo-microarrayinformation, and raw and processed data can be obtainedfrom ArrayExpress [52] under accession number E-TABM-294.Microarray hybridizationFor BAC and PCR arrays, approximately 5 μg ... previously indi-cated by low-resolution BAC microarray analysis [32] actu-ally consisted of an approximately 87.8 kb major domain and an approximately 13.2 kb minor domain, separated by about158 ... nucleosome domains containing modified his-tone H3 dimethylated at Lys4 [23,24]. These domains formon arrays of 0.5 to 1.5 megabases (Mb) of a family of tandemlyrepeated DNA called alpha satellite...
- 19
- 365
- 0
Báo cáo Y học: Identification of the 19S regulatory particle subunits from the rice 26S proteasome potx
... 451–459.12. Fujinami, K., Tanahashi, N., Tanaka, K., Ichihara, A ., Cejka, Z.,Baumeister, W., Miyawaki, M., Sato, T. & N akagawa, H. (1994)Purification and characte rization of th e 26S proteasom e ... fromspinach l ea ves . J. Biol. Chem. 269, 25905–25910.13. Yanagawa, Y. , Ohhashi, A. , Murakami, Y ., Saeki, Y. , Yokosawa,H., Tanaka, K., Hashimoto, J., Sato, T. & Nakagawa, H. (1999)Purification ... Miya, M., Murayama-Kayano, E. et al.(1994) Toward c ataloguing all rice ge nes: large-scale sequencing of randomly chosen rice cDNAs f rom a callus cDNA library. Plant J.6, 615–624.15. Murray,...
- 10
- 495
- 0
Báo cáo Y học: Extra terminal residues have a profound effect on the folding and solubility of a Plasmodium falciparum sexual stage-specific protein over-expressed in Escherichia coli pptx
... UniversityBloomberg School of Public Health, Baltimore, Maryland, USAThe presence of extra N- and C- terminal residues can play a major role in the stability, solubility and yield of recombi-nant ... solubility of a Plasmodium falciparumsexual stage-specificprotein over-expressed inEscherichia coliSushil Prasad Sati1, Saurabh Kumar Singh1, Nirbhay Kumar2 and Amit Sharma11Malaria Group, ... amounts of soluble nativeprotein has necessarily taken the center-stage. Our findingsFig. 3. SDS/PAGE analysis of Pfg27B (A) and Pfg27 A (B) cleavagewith factor Xa. (A) Lane 1, protein standards;...
- 5
- 435
- 0
Từ khóa: báo cáo y họcbáo cáo y học cổ truyềnbáo cáo khoa học y họcbáo cáo y tế học đườngmẫu báo cáo y tế học đườngbáo cáo y tế học đường cuối nămNghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngBáo cáo quy trình mua hàng CT CP Công Nghệ NPVchuyên đề điện xoay chiều theo dạngNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngThơ nôm tứ tuyệt trào phúng hồ xuân hươngThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíchuong 1 tong quan quan tri rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtĐổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt nam