Báo cáo y học: "Nucleolar localization of influenza A NS1: striking differences between mammalian and avian cells" pot

Báo cáo y học: "Nucleolar localization of influenza A NS1: striking differences between mammalian and avian cells" pot

Báo cáo y học: "Nucleolar localization of influenza A NS1: striking differences between mammalian and avian cells" pot

... stained with a rabbit anti-NS1 polyclonal antibody and a mouse anti-NPM monoclonal antibody, revealed with a secondary FITC-labelled anti-rabbit antibody and a secondary RhodamineX-labelled anti-mouse ... Guérin 1,2 Abstract In mammalian cells, nucleolar localization of influenza A NS1 requires the presence of a C-terminal nucleolar locali- zation signal. This nucleo...

Ngày tải lên: 12/08/2014, 04:20

5 256 0
Báo cáo y học: "Conserved epitopes of influenza A virus inducing protective immunity and their prospects for universal vaccine development" doc

Báo cáo y học: "Conserved epitopes of influenza A virus inducing protective immunity and their prospects for universal vaccine development" doc

... to evade adaptive immune response in a variety of mammalian and avian species, including humans. The unpre dictable variability of influenza A viruses, which cause yearly epi- demics in human population, ... that eM2 i s a valid and versatile vaccine candidate to induce protective immunity against any strain of human influenza A viruses, and give a promise for fi...

Ngày tải lên: 12/08/2014, 02:20

13 325 0
Báo cáo y học: "Ocular Manifestations of Rickettsiosis: 1. Mediterranean Spotted Fever: laboratory analysis and case reports" potx

Báo cáo y học: "Ocular Manifestations of Rickettsiosis: 1. Mediterranean Spotted Fever: laboratory analysis and case reports" potx

... Mediterranean and Black seas, in Kenya and other parts of central Africa, South Africa, and certain parts of India. MSF varies in severity but is seldom fatal. The incubation period is 5-7 days and ... in about 50% of cases. The duration of disease is 7-14 days. The clinical signs and symptoms include fever (up to 40°C), headache, chills, myalgias, arthralgias, malaise...

Ngày tải lên: 08/08/2014, 17:20

2 331 0
Báo cáo y học: " Rapid isolation of mycoviral double-stranded RNA from Botrytis cinerea and Saccharomyces cerevisiae" pot

Báo cáo y học: " Rapid isolation of mycoviral double-stranded RNA from Botrytis cinerea and Saccharomyces cerevisiae" pot

... to analyze a large number of fungal isolates it is necessary to have a rapid method that allows the isolation and partial charac- terizat ion of viral dsRNA us ing small amounts of mycelia or yeast ... analysis, and treated with enzymes for their partial characterization. ThemethodallowsgettinghighqualitydsRNA,freeof DNA and ssRNA, and it can be applied to isolate dsRNA from...

Ngày tải lên: 11/08/2014, 21:21

7 319 0
Báo cáo Y học: Immunohistochemical localization of guinea-pig leukotriene B4 12-hydroxydehydrogenase/15-ketoprostaglandin 13-reductase pdf

Báo cáo Y học: Immunohistochemical localization of guinea-pig leukotriene B4 12-hydroxydehydrogenase/15-ketoprostaglandin 13-reductase pdf

... Pharmaceutical Company (Osaka, Japan), and PGs were purchased from Cayman (Ann Arbor, MI, USA). Nitrocellulose membrane was obtained from Amersham (Cleveland, OH, USA). Silica gel 60 thin- layer ... PGE 2 [47]. PGE 2 acts as relaxant of airway smooth muscle, and has protective roles in the airway against inflammation [48]. Airway smooth muscle and epithelial cells also express LTA 4 hy...

Ngày tải lên: 18/03/2014, 01:20

9 271 0
Báo cáo y học: "Extracellular localization of galectin-3 has a deleterious role in joint tissues" docx

Báo cáo y học: "Extracellular localization of galectin-3 has a deleterious role in joint tissues" docx

... Base pairs Reference ADAMTS-5 S: GGCATCATTCATGTGACAC AS: GCATCGTAGGTCTGTCCTG 364 MMP-3 S: GAAAGTCTGGGAAGAGGTGACTCCAC AS: CAGTGTTGGCTGAGTGAAAGAGACCC 284 Osteocalcin S: CATGAGAGCCCTCACA AS: AGAGCGACACCCTAGAC 310 ... AGAGCGACACCCTAGAC 310 [48] Alkaline phosphatase S: TGCAGTACGAGCTGAACAG AS: TGAAGACGTGGGAATGGTC 267 Type I collagen α1 chain S: CCGAAGGTTCCCCTGGACGA AS: CGCCCTGTTCGCCTGTCTCA 252 18S...

Ngày tải lên: 09/08/2014, 10:20

9 351 0
Báo cáo y học: "Immunohistochemical localization of mu opioid receptor in the marginal division with comparison to patches in the neostriatum of the rat brain" docx

Báo cáo y học: "Immunohistochemical localization of mu opioid receptor in the marginal division with comparison to patches in the neostriatum of the rat brain" docx

... plays key roles in analgesia and also has effects on learning and memory. The presence of both enkephalin andMORintheMrDsuggeststhatMORmightplaya role in the learning and memory f unctions of ... moon shape band that parallels with the subcallosal streak. C: At the caudomedial portion of the St, MOR-immunoreactivity was seen densely stained in the band of nerve fibers that arran...

Ngày tải lên: 10/08/2014, 05:21

9 370 0
Báo cáo y học: "Co-localization of CENP-C and CENP-H to discontinuous domains of CENP-A chromatin at human neocentromeres" ppsx

Báo cáo y học: "Co-localization of CENP-C and CENP-H to discontinuous domains of CENP-A chromatin at human neocentromeres" ppsx

... Oligo-microarray information, and raw and processed data can be obtained from ArrayExpress [52] under accession number E-TABM- 294. Microarray hybridization For BAC and PCR arrays, approximately 5 μg ... previously indi- cated by low-resolution BAC microarray analysis [32] actu- ally consisted of an approximately 87.8 kb major domain and an approximately 13.2 kb minor domain, separa...

Ngày tải lên: 14/08/2014, 08:20

19 366 0
Báo cáo Y học: Identification of the 19S regulatory particle subunits from the rice 26S proteasome potx

Báo cáo Y học: Identification of the 19S regulatory particle subunits from the rice 26S proteasome potx

... 451–459. 12. Fujinami, K., Tanahashi, N., Tanaka, K., Ichihara, A ., Cejka, Z., Baumeister, W., Miyawaki, M., Sato, T. & N akagawa, H. (1994) Purification and characte rization of th e 26S proteasom e ... from spinach l ea ves . J. Biol. Chem. 269, 25905–25910. 13. Yanagawa, Y. , Ohhashi, A. , Murakami, Y ., Saeki, Y. , Yokosawa, H., Tanaka, K., Hashimoto, J., Sato, T. & Nak...

Ngày tải lên: 08/03/2014, 16:20

10 495 0
Báo cáo Y học: Extra terminal residues have a profound effect on the folding and solubility of a Plasmodium falciparum sexual stage-specific protein over-expressed in Escherichia coli pptx

Báo cáo Y học: Extra terminal residues have a profound effect on the folding and solubility of a Plasmodium falciparum sexual stage-specific protein over-expressed in Escherichia coli pptx

... University Bloomberg School of Public Health, Baltimore, Maryland, USA The presence of extra N- and C- terminal residues can play a major role in the stability, solubility and yield of recombi- nant ... solubility of a Plasmodium falciparum sexual stage-specific protein over-expressed in Escherichia coli Sushil Prasad Sati 1 , Saurabh Kumar Singh 1 , Nirbhay Kumar 2 and Amit...

Ngày tải lên: 23/03/2014, 21:20

5 436 0
w