báo cáo khoa học: " Genetic transformation of cotton with a harpin-encoding gene hpaXoo confers an enhanced defense response against different pathogens through a priming mechanism" potx

... Genetic transformation of cotton with a harpin-encoding gene hpaXoo confers an enhanced defense response against different pathogens through a priming mechanism BMC Plant Biology 2010, 10:67 Miao ... (AJ223969 ) forward:5'-AGACCACCAAGTACTACTGCAC-3' reverse:5'-CCACCAATCTTGTACACATCC-3' 58 495 Ghdhg- OMT(GQ303569 ) forward:5'-ATGA...

Ngày tải lên: 12/08/2014, 03:21

... (distilled water). No PCR positives were obtained from any of the experimental groups A- C. Narushima et al. Acta Veterinaria Scandinavica 2011, 53:3 http://www.actavetscand.com/content/53/1/3 Page 3 of ... the article Narushima et al. Acta Veterinaria Scandinavica 2011, 53:3 http://www.actavetscand.com/content/53/1/3 © 2011 Narushim a et al; lice nsee B ioMed Central Ltd. This is an...

Ngày tải lên: 12/08/2014, 18:22

... Martin LA, Dandekar AM (1988) Agrobacterium- mediated transformation of walnut somatic embryos and regeneration of transgenic plants. Bio/Technology 6, 800-804 McGranahan GH, ... 133-141 Naina NS, Gupta PK, Mascarenhas AF (1989) Genetic transformation and regeneration of transgenic neem (Azadirachta indica) plants using Agrobacterium tumefaciens. Curr...

Ngày tải lên: 08/08/2014, 23:22

... homology with PCV-2 isolates from USA, Canada and France. But Canadian isolates such as AF085695, AF086834, AF086835 and AF086836 showed slightly lower homology of 96 % with two Korean isolates. Mache ... strand F1 F2 R1 1768R 1696F 433R ACCAGCGCACTTCGGCAG TGAGTACCTTGTTGGAGAGC GTAATCCTCCGATAGAGAGC AATACTTACAGCGCACTTCTTTCG GGTGTCTTCTTCTGCGGTAACG TCCAACAAGGTACTCACAGCAG 18nt 20nt 20nt 24nt...

Ngày tải lên: 07/08/2014, 15:20

... distribution and characteristics of serum proteins of CNH and to get a basic data for pedigree establishment and maintenance of purity of the CNH. Materials and Methods 1) Experim ental animals Three different ... between Asia and European’s horses [15]. It was reported that GC locus is comprised of F and S alleles[3, 5] and ES locus is comprised of F, G, H, I, S, O and R alle...

Ngày tải lên: 07/08/2014, 15:20

... snsivaselvam@hotmail.com Genetic characterization of Barbari goats using microsatellite markers J. Ramamoorthi, K. Thilagam, S. N. Sivaselvam * , S. M. K. Karthickeyan Department of Animal Genetics and Breeding, Madras Veterinary ... part of India, known for better milk and meat quality, was studied as a part of genetic characterization and conservation. The genomic DNA from...

Ngày tải lên: 07/08/2014, 23:22

... deer samples from Scotland were 19fwd (5’ ATT TTG CAG ATA AGT CAT C 3’), 778rev (5’ AGA AGA TAA TGA AAA CAG GAA G 3’) and 315fwd (5’ CAG TAA ACC AAA AAC CAA C 3’). A detailed description of ... highest genetic distance value was between the red deer from Italy and mainland Scotland (0.089). The distance value between the Italian and Isle of Rhum deer was 0.078 and that between...

Ngày tải lên: 07/08/2014, 23:22

... ORF 1a and 1b are located immediately downstream of the 5’ untranslated region (UTR) and involved in virus transcription and replication. ORFs 2 to 7 are located at the 3’ end of the genome and ... 329-339. 11. de Lima M, Pattnaik AK, Flores EF, Osorio FA. Serologic marker candidates identified among B-cell linear epitopes of Nsp2 and structural proteins of a North American st...

Ngày tải lên: 07/08/2014, 23:22

... discussed. 2. MATERIALS AND METHODS 2.1. Experimental trial A1 2× 12 half-diallel was used to estimate the phenotypic vari- ability and the genetic parameters (variance components, heritabilities and genetic ... single-trait genetic gains are expected The main requirements of forest managers and pulp manu - facturers can be roughly summarized as an increase in yield and an improv...

Ngày tải lên: 08/08/2014, 14:20

... torminalis (L.) Crantz, Revue Forestière Française 3 (1993) 229-243. [6] Frascaria N., Santi F., Gouyon P.H., Genetic differentia- tion within and among populations of chestnut ( Castanea sati- va Mill.) ... among groups. For the comparison between France and Central Europe, stan- dard errors of diversity parameters were based on the sampling of loci. Multivariate analyses (factoria...

Ngày tải lên: 08/08/2014, 14:21