báo cáo khoa học: " A saturated SSR/DArT linkage map of Musa acuminata addressing genome rearrangements among bananas" docx
... TCAAGTATTTCACCGTATTGC TTACCACCCTGTCATCTTTC 55 207 mMaCIR114 AM950340 (AC)7,(CT)28 8 GCAAGCCAAAGGGAA ACCAACAAAGAATGGTGTAA 54 222 mMaCIR115 AM950341 (CA)2, 11 CAAGAGACTACCACCGAAGA TGATTCTCACGACGTATGG ... ACGCATGGTAAAGTGGAA ACATTCAAATCACGTTGCT 55 111 mMaCIR109 AM950335 (CA)13, 4 ACTCTAGTTCCAGAATAACTCCA CAATCTTCATTAGCCAGTTGT 55 204 mMaCIR110 AM950336 (AC)7,(GA)6, 3 GGTGAACTGATGTGCGA TCTTTCAACGGAA...
Ngày tải lên: 12/08/2014, 03:21
... 199–202. [2] Ahn S., Tanskley S., Comparative linkage maps of the rice and maize genomes, Proc. Natl. Acad. Sci. USA 90 (1993) 7980–7984. [3] Arcade A. , Anselin F., Faivre Rampant P., Lesage M.C., Laurans ... 17 25 E+ACAA/M+CCGA 110 4 5 9 26 E+ACAA/M+CCTT 136 17 4 21 27 E+ACAA/M+CCTG 70 9 4 13 28 E+ACAA/M+CCAG 75 10 4 14 29 E+ACAA/M+CCAT 110 12 4 16 30 E+ACAC/M+CCAA 100 9 2 11 31 E+ACAC...
Ngày tải lên: 08/08/2014, 14:20
... low scan rates, but for higher scan rates, it reaches a noticeable plateau. Such a relationship between T max and scan rate indicates that this type of equilibrium thermodynamic analysis can be ... quantitative validation of the two-state reversible interpretation of the denaturation of the [TetR– Tc] complex was obtained using a vant’Hoff analysis of the CD data. Taking into...
Ngày tải lên: 20/02/2014, 02:21
Tài liệu Báo cáo khoa học: A single amino acid substitution of Leu130Ile in snake DNases I contributes to the acquisition of thermal stability A clue to the molecular evolutionary mechanism from cold-blooded to warm-blooded vertebrates docx
... reagent grade and available commercially. The snakes and Japanese white rabbits were acquired, main- tained and used in accordance with the Guidelines for the Care and Use of Laboratory Animals ... a relatively tight cluster, while the snake (E. quadrivirgata, E. climacophora and A. blomhoffii), amphibian (X. laevis, Rana catesbeiana, Bufo vulgaris japonicus and Cynops pyrrhogaster), avian...
Ngày tải lên: 20/02/2014, 23:20
Tài liệu Báo cáo khoa học: "A Word-to-Word Model of Translational Equivalence" pptx
... over all candidate translations. The correct translations of a word that has several correct trans- lations will be assigned a lower probability than the correct translation of a word that has ... inducing or applying a full translation model. For these applications, we have designed a fast algorithm for esti- mating a partial translation model, which accounts for trans...
Ngày tải lên: 22/02/2014, 03:20
Báo cáo khoa học: "A Corpus for Modeling Morpho-Syntactic Agreement in Arabic: Gender, Number and Rationality" docx
... 55(3):189– 213. Mohamed Altantawy, Nizar Habash, Owen Rambow, and Ibrahim Saleh. 2010. Morphological Analysis and Generation of Arabic Nouns: A Morphemic Func- tional Approach. In Proceedings of the seventh ... Republic. Khaled Elghamry, Rania Al-Sabbagh, and Nagwa El- Zeiny. 2008. Cue-based bootstrapping of Arabic se- mantic features. In JADT 2008: 9es Journées interna- tionales d’An...
Ngày tải lên: 07/03/2014, 22:20
Báo cáo khoa học: " A Tool for Error Analysis of Machine Translation Output" doc
... context-based machine translation evaluation. Machine Translation, 17(1):43–75. Masaki Murata, Kiyotaka Uchimoto, Qing Ma, Toshiyuki Kanamaru, and Hitoshi Isahara. 2005. Analysis of machine translation ... existing annota- tions, and for searching among annotations. BLAST can handle two types of annotations: er- ror annotations and support annotations. Error an- notations are based on...
Ngày tải lên: 07/03/2014, 22:20
Báo cáo khoa học: "A System for Semantic Analysis of Chemical Compound Names" pdf
... Ennis, Janna Hastings, Martin Zbinden, Alan McNaught, Rafael Alc ´ antara, Michael Darsow, Micka ¨ el Guedj, and Michael Ashburner. 2008. ChEBI: a database and ontology for chemical entities of biological interest. ... morpheme’s meanings, complicate auto- matic classification and mapping of the names. To achieve mapping of synonymous chemical compound names, name normalization is a...
Ngày tải lên: 08/03/2014, 01:20
Báo cáo khoa học: "A Nonparametric Method for Extraction of Candidate Phrasal Terms" docx
... the analysis so as not to bias the results against them. Separate lists of bigrams and trigrams were extracted and ranked according to several standard word association metrics. Rank ratios ... frequency measures such as c-values (Frantzi, Anadiou & Mima 2000, Maynard & Anadiou 2000) and standard statistical significance tests such as the t-test, the chi-squared test, and lo...
Ngày tải lên: 08/03/2014, 04:22
Báo cáo khoa học: "A Framework for Customizable Generation of Hypertext Presentations" pdf
... Proceedings of the 9th International Workshop on Natural Language Generation, Ontario, Canada. 722 Presentation Core Generator Domain Data , Manager Macro-Planner ~ - i Y [Micro-Planner ... parameters when the exemplar is called. • Conditions of evaluation: Specification of the conditions under which the exemplar can be evaluated. • Data: Specification of domain d...
Ngày tải lên: 08/03/2014, 05:21