báo cáo khoa học: " Identification and characterisation of CYP75A31, a new flavonoid 3’5’-hydroxylase, isolated from Solanum lycopersicum" pdf
báo cáo khoa học: " Identification and characterisation of CYP75A31, a new flavonoid 3’5’-hydroxylase, isolated from Solanum lycopersicum" pdf
... 10:21 http://www.biomedcentral.com/1471-2229/10/21 Page 8 of 12 RESEARC H ARTIC L E Open Access Identification and characterisation of CYP7 5A3 1, a new flavonoid 3’5’-hydroxylase, isolated from Solanum lycopersicum Kristine M Olsen 1* , Alain Hehn 2 , ... coli Q96418_Eustoma_ g randiflorum Q96418_Campanula_medium BAD34460_Eustoma_grandifloru m Q96581_Gentina_triflor...
Ngày tải lên: 12/08/2014, 03:21
báo cáo khoa học: " Identification and characterisation of seed storage protein transcripts from Lupinus angustifolius" docx
... seeds pooled from 4-8 DAA, 9-12 DAA, 13-16 DAA, 17-20 DAA, 21-26 DAA, 27-32 DAA, 33-38 DAA and 39-44 DAA, respectively. For each gene there was a large increase in expression ranging from 10 3 to ... awareness in many societies of the escalating incidence of obesity and the associated risk of diabetes and cardiovascular disease, NLL is an excellent candi- date as a healthy...
Ngày tải lên: 11/08/2014, 11:21
Báo cáo khoa học: "Identification and characterisation of a novel anti-viral peptide against avian influenza virus H9N" pps
... 5'ATTTAAGGATCCGAGAGCCATGGA 3' pC-HA-R 5'ATGCTGCTCGAGTTATATACAAATGTTGC 3' pC-NA-F 5'CATAGAATTCGCAAAAGCAGGAGT 3' pC-NA-R 5'TATCGCTCGAGAGTAGAAACAAGGAG 3' pC-P1-FP 5'AGCCTGGAATTCATGAAAAAATTA ... NA, HA t and P1genes Primers Sequence pY-NA-F a 5' CATAGAATTCGCAAAAGCAGGAGT 3' pY-NA-R 5' TATCGCTCGAGAGTAGAAACAAGGAG 3' pY-HA t -F 5&ap...
Ngày tải lên: 12/08/2014, 04:21
Báo cáo khoa học: " Identification and prevalence of Ehrlichia chaffeensis infection in Haemaphysalis longicornis ticks from Korea by PCR, sequencing and phylogenetic analysis based on 16S rRNA gene" docx
... chaffeensis strains available in the GenBank database showed that EC- PGHL was 100% identical or similar to the Arkansas (AF416764), the Sapulpa (U60476) and the 91HE17 (U23503) strains, all of these ... accession number AY35042) with the sequences of 20 E. chaffeensis strains available in the database showed that EC-PGHL was 100% identical or similar to the Arkansas (AF416764), the Sap...
Ngày tải lên: 07/08/2014, 18:21
báo cáo khoa học: " Identification and analysis of common bean (Phaseolus vulgaris L.) transcriptomes by massively parallel pyrosequencing" doc
... of genesexpressedinthecommonbeanwillhelpinthe development of an accurate and complete structural annotation of the common bean genome, a valid tran- scriptome map, and the identification of the genetic basis of agriculturally important traits in ... developmental pathways. The second largest TF family in common bean (77) has similarity with the (NAM, ATAF1, 2 and CUC2) fam...
Ngày tải lên: 11/08/2014, 11:21
báo cáo khoa học: " Identification and characterization of the Nonrace specific Disease Resistance 1 (NDR1) orthologous protein in coffee" doc
... pGEM-T clone (GenBank:DQ335596) as a template and the following pri- mers: CaNDR1-BglII 5’-TCAGATCTTATGGACA AAG- GATGGGGC-3’,andCaNDR1-BstEII 5’-T AGGTCAC CAAATTAATTCCCAGGAAA-3’.DigestedPCRpro- ducts ... GAC GTA CCA GAT TAT ATG TC AGA CCC CAG CAG CAG TGC-3’ and CaNDR1-Reverse 3, 5’-CTA ATG GTG ATG GTG ATG GTG CAA CAG CAG AAC CAA GAA A- 3’. The primers used for obtaining the single HA-t...
Ngày tải lên: 11/08/2014, 11:21
báo cáo khoa học: "Identification and analysis of phosphorylation status of proteins in dormant terminal buds of poplar" pptx
... regulated during the release of dormancy, such as acetyl-CoA carboxylase (ACCase), chalcone synthase, chalcone isomerase, and f lavonol syn thase [12,65- 67]. Acetyl-CoA carboxylase (ACCase) catalyzes ... out experimental work, participated in data analyses, and drafted the manuscript. CFL and ZYS participated in the design of the study and performed in silico analyses. All author...
Ngày tải lên: 11/08/2014, 11:21
báo cáo khoa học: " Identification and characterization of wheat long non-protein coding RNAs responsive to powdery mildew infection and heat stress by using microarray analysis and SBS sequencing" ppsx
... Omura Y, Abe K, Kamihara K, Katsuta N, Sato K, Tanikawa M, Yamazaki M, Ninomiya K, Ishibashi T, Yamashita H, Murakawa K, Fujimori K, Tanai H, Kimata M, Watanabe M, Hiraoka S, Chiba Y, Ishida S, Ono ... Y, Nagahari K, Murakami K, Yasuda T, Iwayanagi T, Wagatsuma M, Shiratori A, Sudo H, Hosoiri T, Kaku Y, Kodaira H, Kondo H, Sugawara M, Takahashi M, Kanda K, Yokoi T, Furuya T, Kikkawa E, Omura...
Ngày tải lên: 11/08/2014, 11:21
báo cáo khoa học: " Identification and characterization of flowering genes in kiwifruit: sequence conservation and role in kiwifruit flower development" ppt
... norma l and aberrant flowers. R eal-time RT-PCR analysis of the Actinidia flowering genes in the leaf and floral organs of A. deliciosa ’Hayward’ (female, normal), ‘Chieftain’ (male, normal) and ... lemma and palea and is an early-acting regulator of inner floral organs. Plant J 2005, 43(6):915-928. 74. Prasad K, Sriram P, Kumar CS, Kushalappa K, Vijayraghavan U: Ectopic expr...
Ngày tải lên: 11/08/2014, 11:22
báo cáo khoa học: " Identification and characterization of plant Haspin kinase as a histone H3 threonine kinase" ppsx
... aurora-like kinases in Arabidopsis and other plants. Plant Cell 2005, 17(3):836-848. 11. Kawabe A, Matsunaga S, Nakagawa K, Kurihara D, Yoneda A, Hasezawa S, Uchiyama S, Fukui K: Characterization ... Multiple alignment of Haspin kinases in the kinase domain. (A) KinasedomainsfromAnopheles gambiae (EAA05110), Aquilegia caerulea (AcoGoldSmith_v1.025146m), Arabidopsis rylata (XP_002889750)...
Ngày tải lên: 11/08/2014, 11:22