báo cáo khoa học: " Analysis of a c0t-1 library enables the targeted identification of minisatellite and satellite families in Beta vulgaris" ppt
báo cáo khoa học: " Analysis of a c0t-1 library enables the targeted identification of minisatellite and satellite families in Beta vulgaris" ppt
... ATAATCATACCTCTATGCCTATTCCAAGTTCTAATGGCTAATGCAAGTCCTAAAATACTCATTTAAACTTTCTACTACATGGTTGTAAGATTCTAAGCAAGTTTAATACACTTAGCCAATTAAAATGAGAAAAACTAAGCCATTTCGAGCCGTTTTTTGGGTTTCATGTTCCTHinfI -satellite 325 2 ... TGTGACTTGTAACATTGCGCGGGTGCTTGGCACCATTTGCGTTACCTCAAAAAGCCTTTGAACACCCCAATTATTCATTTCTCGCGAAATCCAAAATTGCCTCGAAATGAACGTAAAGGCATCCACATATTTGTTCCAAGCCACATGACTCCTTTACATTGACCTCCTATGTCCCTAGGAGGCATCCCGTGCCATTTGGAGCTCGGGCAACGGGAAAGTCCGAAAGCGTGTATAATCTTCAATTTTAGTTGTTTTTGGGGAATTTTTGGACTACTTCTTCAGGCCCGGTCATATTTTTCTTTCGAAACATTCCTAGGAGTGCCGA The ... GTTTGTTCTTAAAAGGTTGTTCTTGAATTATTATTCAAGTGTTTGGAAAGABvMSat04 96 2 41 70 - 100 DX983375 CCTCTAAATGTAAGTGGCTTTAGCAGCACTATAAGTTCTGTGCCTAAAAAAGGTGGCATTACGGGCAACCAACAATTAGCGACAGGCATATGGTTGFokI-satellite...
- 14
- 270
- 0
báo cáo khoa học: "MeRy-B: a web knowledgebase for the storage, visualization, analysis and annotation of plant NMR metabolomic profiles" potx
... application and database for the management and analysis of NMR plant metabolomicsprofiles, filling the gap in centralized informat ion in thisarea. This platform manages all the data produced by a metabolomics ... files, as such files are alreadyavailable as part of the quality assurance approach oper-ating in most laboratories: standard operating proce-dures (SOPs) are available and users therefore wastelittletimeuploadingthesedataintotheMeRy-Bdatabase. The ... 12renders the data publicly available, the system alerts the administrator and allows him or her to curate the data and to validate the definitive inclusion of the data intoMeRy-B.Consulting a metabolomics...
- 12
- 368
- 0
Báo cáo khoa học: " Is there a special mechanism behind the changes in somatic cell and polymorphonuclear leukocyte counts, and composition of milk after a single prolonged milking interval in cows" pptx
... supervised and partic-ipated in the practical work and neutrophil counting,assisted in interpretation of the results and was mainresponsible for supporting the drafting and for revision of the manuscript. ... respectively.However, a significant increase was recorded again in the afternoon milking day 3 and the protein percentage there-after remained significantly increased in both morning and afternoon milk, ... interval = the time between morning and after-noon milking. Data represent the LS-means. SE for fat, protein and lactose in morning and afternoon milk was 0.13 and 0.16; 0.06 and 0.05; and 0.03 and...
- 10
- 397
- 0
Tài liệu Báo cáo khoa học: High affinity copper binding by stefin B (cystatin B) and its role in the inhibition of amyloid fibrillation docx
... protein, lacking the copper binding domain is cap-able of domain swapping and forms a dimer as revealedby crystal structure analysis [36]. In our case, SEC datacollected for samples at pH 7 have ... pH 5 using5mM Mes as a buffer. Shown are stefin A and stefin B at pH 5 and variant 2 of ste-fin B and the P79S mutant of the variant atboth pH 7 and pH 5. Each panel is a plot of heat change on ... nm.AcknowledgementsWe thank Louise Kroon Zˇitko and Manca Kenig forcloning and isolating the recombinant proteins. Wealso are grateful to Sabina Rabzelj and Sasˇ a JenkoKokalj for performing certain SEC...
- 14
- 586
- 0
Báo cáo khoa học: Recent insights into cerebral cavernous malformations: the molecular genetics of CCM pot
... identification of several of the biochemical pathways involving CCM proteins aswell as the analysis of several fish and mouse CCManimal models has already provided a number of cluesto this goal (see Faurobert ... sporadically and in a familialcontext. The proportion of familial cases has been esti-mated to be as high as 50% in Hispano-AmericanCCM patients [2] and close to 10–40% in Caucasianpatients ... U (2009) Functional ana-lyses of human and zebrafish 18-amino acid in- framedeletion pave the way for domain mapping of the cere-bral cavernous malformation 3 protein. Hum Mutat Jun30, 1003–1011.27...
- 6
- 356
- 0
Báo cáo khoa học: Alpha 1,3-fucosyltransferase-VII regulates the signaling molecules of the insulin receptor pathway potx
... Sasaki K, Kurata K, Funayama K, Nagata M, Watana-be E, Ohta S, Hanat N & Nishi T (1994) Expressioncloning of a novel a1 ,3-fucosyltransferase that isinvolved in biosynthesis of the sialyl ... con-taining 10% fetal bovine serum, penicillin and streptomy-cin as described previously [5,20]. In the treatment of InRkinase inhibitor and SLexmAb, the final concentration of HNMPA-(AM)3, and ... image software. The quantitative datawere obtained by the intensity ratios of a1 ,3FucT-VII ⁄b-actin band.Detection of the expression of SLex, InR -a subunit and EGFR on the cell surface using...
- 13
- 354
- 0
Báo cáo hóa học: " Research Article A Hybrid Technique for the Periodicity Characterization of Genomic Sequence Data" ppt
... Silverman and R. Linsker, A measure of DNA periodic-ity,” Journal of Theoretical Biology, vol. 118, no. 3, pp. 295–300,1986.[23] S. Tiwari, S. Ramachandran, A. Bhattacharya, S. Bhattacharya, and ... A very similar characteristic is observed in the distribution of distances between TT to TT dinucleotides in [11], and in the distribution of AAAA to AAAA tetramer distances in [33], suggesting ... “Improvement of spectral analysis as a genomic analysis tool,” in Proceedings of the 5th IEEEInternational Workshop on Genomic Signal Processing and Statistics (GENSIPS ’07), Tuusula, Finland, June...
- 8
- 382
- 0
Báo cáo khoa học: "How do plant defense compounds influence the oviposition behaviour of small cabbage white butterfly Pieris rapae (Linnaeus)" potx
... were artificially damaged and treated with the regurgitant of Spodoptera exigua larvae on the damaged site, produced the same blend of volatiles as plants that are damaged by the caterpillars ... Zevenbergen**, Maaike Bruinsma** and Joop van Loon*** Research affairs and International cooperation office ** Entomology laboratory- Wageningen University- The Netherlands Abstract Jasmonic acid ... sprouts plants (Brassica oleracea gemmifera, cv. Cyrus) is investigated. A JA concentration of 0.1 mM and attack of P. rapae caterpillars negatively affect the oviposition behavior of the butterfly:...
- 8
- 255
- 0
báo cáo khoa học: " Ovarian cryopreservation after laparoscopic ovariectomy using the Endo-GIA stapling device and LAPRO-clip absorbable ligating clip in a woman: a case report" ppt
... surgical management. JL and AM performed the ovariancryopreservation and were major contributors in writing the manuscript. Allauthors read and approved the final manuscript.Competing interests The ... CAS E REP O R T Open AccessOvarian cryopreservation after laparoscopicovariectomy using the Endo-GIA stapling device and LAPRO-clip absorbable ligating clip in a woman: a case reportIsabelle ... cystectomyadversely affects ovarian func tion [5, 6]. Thes e data showpossible impact of electrocoagulatory ovarian tissuedamage on the outcome of ovarian tissue harvesting and reimplantation. Further...
- 3
- 203
- 0
Báo cáo khoa hoc:" Divine intervention? A Cochrane review on intercessory prayer gone beyond science and reason" pdf
... that the patientswere randomised many years after their outcomes hadoccurred and did not discuss the likelihood that time cango backwards and that prayer can wake the dead. The author of the ... life again. In fact, all the randomi-sation did was to divide the living and the dead into twogroups that were then compared statistically. This ismeaningless[4], also because we already knew ... authors' theological reasoning, all scientificresearch would become meaningless, and we thereforeexamine their main arguments below.Methodology of the Cochrane review The authors state in the background...
- 4
- 207
- 0
Từ khóa: báo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpbáo cáo khoa học thủy sảnBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018chuyên đề điện xoay chiều theo dạngNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXChuong 2 nhận dạng rui roBT Tieng anh 6 UNIT 2Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015