báo cáo khoa học: " Cytosolic N-terminal arginine-based signals together with a luminal signal target a type II membrane protein to the plant ER" ppsx

báo cáo khoa học: " Cytosolic N-terminal arginine-based signals together with a luminal signal target a type II membrane protein to the plant ER" ppsx

báo cáo khoa học: " Cytosolic N-terminal arginine-based signals together with a luminal signal target a type II membrane protein to the plant ER" ppsx

... CGGGGTACC CCATGACCGGAGCTAGCCGTCGGAGCGCGCGTGGTCGAATCAGTAAACGGAATCCGAAG FCNX11XYLT35 CGGGGTACC CCATGAATGATCGTAGACCGCAAAGGAAACGCCCAAGTAAACGGAATCCGAAG-3' RXYLT35 GGACTAGT TGAAAACGACGATGAGTG FXYLT35' GCTCTAGA GCATGAGTAAACGGAATCCG RXYLT35' ... CGGGGTACC CCATGAAATCATCATCATTATCTCCC FR/L4 CGGGGTACC CCATGACCGGAGCTAGCCTTCTGAGCGCGCTTGGTCTAATCAAATCATCA FR /A4 CGGGGTACC CCATGACCGGAGCTAGCGCTG...
Ngày tải lên : 12/08/2014, 03:21
  • 22
  • 235
  • 0
Báo cáo khoa học: Cytosolic phospholipase A2-a and cyclooxygenase-2 localize to intracellular membranes of EA.hy.926 endothelial cells that are distinct from the endoplasmic reticulum and the Golgi apparatus pdf

Báo cáo khoa học: Cytosolic phospholipase A2-a and cyclooxygenase-2 localize to intracellular membranes of EA.hy.926 endothelial cells that are distinct from the endoplasmic reticulum and the Golgi apparatus pdf

... J, Takano T, Papillon J, Khadir A & Cybulsky AV (2001) Cytosolic phospholipase A2 -alpha associates with plasma membrane, endoplasmic reticulum and nuclear membrane in glomerular epithelial ... may function together at a distinct and novel compartment for eicosanoid signalling. Abbreviations Con A, concanavalin A; COX, cyclooxygenase; cPLA 2 -a, cytosolic phospholipase...
Ngày tải lên : 16/03/2014, 18:20
  • 13
  • 387
  • 0
Báo cáo khoa học: "Conserved positive selection signals in gp41 across multiple subtypes and difference in selection signals detectable in gp41 sequences sampled during acute and chronic HIV-1 subtype C infection" potx

Báo cáo khoa học: "Conserved positive selection signals in gp41 across multiple subtypes and difference in selection signals detectable in gp41 sequences sampled during acute and chronic HIV-1 subtype C infection" potx

... florette.treurnicht@uct.ac.za; Koleka Mlisana - mlisanak@ukzn.ac.za; Salim S Abdool Karim - karims1@ukzn.ac.za; Carolyn Williamson - carolyn.williamson@uct.ac.za; The CAPRISA 002 Acute Infection Study Team - caprisa@ukzn.ac.za * ... signals that were more similar to one another than to those detectable in other HIV-1 subtypes. This test clearly indi- cated that selection signals de...
Ngày tải lên : 12/08/2014, 04:21
  • 16
  • 242
  • 0
Tài liệu Báo cáo khoa học: Structure of RNase Sa2 complexes with mononucleotides – new aspects of catalytic reaction and substrate recognition pptx

Tài liệu Báo cáo khoa học: Structure of RNase Sa2 complexes with mononucleotides – new aspects of catalytic reaction and substrate recognition pptx

... was to better understand the catalytic mechanism of RNase Sa2 and to account for the differences in catalytic activity between RNases Sa2 and Sa. On the basis of the crystal structures of RNase ... RNase Sa [31]. An R6 5A mutation in RNase Sa caused k cat to decrease by three orders of magnitude. Because Arg65 in RNase Sa is structurally equivalent to Arg67 in RNase Sa2, and...
Ngày tải lên : 18/02/2014, 11:20
  • 13
  • 523
  • 0
Tài liệu Báo cáo khoa học: Modeling of tRNA-assisted mechanism of Arg activation based on a structure of Arg-tRNA synthetase, tRNA, and an ATP analog (ANP) ppt

Tài liệu Báo cáo khoa học: Modeling of tRNA-assisted mechanism of Arg activation based on a structure of Arg-tRNA synthetase, tRNA, and an ATP analog (ANP) ppt

... Tsurumi, Yokohama 230-0045, Japan Database The atomic coordinates and the structure factors have been deposited in the Protein Data Bank (ID 2ZUE for the ternary complex of ArgRS, tRNA Arg CCU and ANP, and ... synthesized Arg-AMP to tRNA, the facts that the K m values for the cognate amino acids in the aminoacylation reaction on ArgRS, GlnRS and GluRS are not the same as...
Ngày tải lên : 18/02/2014, 11:20
  • 17
  • 512
  • 0
Tài liệu Báo cáo khoa học: Identification of two late acyltransferase genes responsible for lipid A biosynthesis in Moraxella catarrhalis doc

Tài liệu Báo cáo khoa học: Identification of two late acyltransferase genes responsible for lipid A biosynthesis in Moraxella catarrhalis doc

... TTG ATG AGC CTA CCA (atr sense) This study atr2 TGC TGA TGA TGG CAA CTC (atr antisense) This study asd1 AAG CCG ATG ACA CCA ATT (asd sense) This study asd2 GCA GGT TCA TAG TGC ATG (asd antisense) ... O35ElpxL, the colonies on the chocolate agar plates were similar to those of the parental strain, and the growth rate in BHI broth in logarithmic phase was also similar to that of th...
Ngày tải lên : 18/02/2014, 14:20
  • 14
  • 674
  • 0
Tài liệu Báo cáo khoa học: Seed-based systematic discovery of specific transcription factor target genes pptx

Tài liệu Báo cáo khoa học: Seed-based systematic discovery of specific transcription factor target genes pptx

... using the MluI ⁄ XhoI tailed primers DARSfw (5¢-ACTACGCGTAGTCCAAGAGAGGAGAAACC -3¢) and DARSrv (5¢-ACTCTCGAGCCCGGAGCGCTGGCG GCCGC-3¢), and NFKBIAfw (5¢-ACTGAGCTCCCGA CGACCCCAATTCAAATCG-3¢) and NFKBIArv ... of transcriptome data available in databases can be used to strongly enhance the prediction of transcription factor targets for cases in which targeted microarray experiments are not a...
Ngày tải lên : 18/02/2014, 18:20
  • 15
  • 500
  • 0
Tài liệu Báo cáo khoa học: Insulin-dependent phosphorylation of DPP IV in liver Evidence for a role of compartmentalized c-Src ppt

Tài liệu Báo cáo khoa học: Insulin-dependent phosphorylation of DPP IV in liver Evidence for a role of compartmentalized c-Src ppt

... & Walborg EF Jr (1983) Characterization of a family of glycoproteins associated with the bile canalicu- lar membrane of normal hepatocytes but not expressed by two transplantable rat hepatocellular ... DPP IV has shown that the luminal domain of DPP IV carries dominant apical sorting information while the short cytoplasmic tail and the transmembrane domain contain competin...
Ngày tải lên : 19/02/2014, 07:20
  • 12
  • 738
  • 0
Tài liệu Báo cáo khoa học: Temperature and phosphate effects on allosteric phenomena of phosphofructokinase from a hibernating ground squirrel (Spermophilus lateralis) pptx

Tài liệu Báo cáo khoa học: Temperature and phosphate effects on allosteric phenomena of phosphofructokinase from a hibernating ground squirrel (Spermophilus lateralis) pptx

... increasing the pH slightly to a value of 7.3 dramatically altered the effect of phosphate and activation was seen only at low concentrations with a maximal 1.7-fold activation at 2 mm phosphate. At Table ... temperature so that the pH at 5 °C was 7.5 and the pH at 37 °C was 7.2. The concentration of F6P was held at 0.5 m M. All other assay conditions are detailed in the Ma...
Ngày tải lên : 19/02/2014, 16:20
  • 9
  • 579
  • 0
Tài liệu Báo cáo khoa học: "Large-Scale Syntactic Language Modeling with Treelets" docx

Tài liệu Báo cáo khoa học: "Large-Scale Syntactic Language Modeling with Treelets" docx

... The Association for Machine Transla- tion in the Americas. David Chiang. 2005. A hierarchical phrase-based model for statistical machine translation. In The Annual Con- ference of the Association ... generative baselines on several evaluation metrics and achieves the same perfor- mance as state-of -the- art discriminative classifiers specifically trained on several types of negative...
Ngày tải lên : 19/02/2014, 19:20
  • 10
  • 463
  • 0

Xem thêm