báo cáo khoa học: " Cytosolic N-terminal arginine-based signals together with a luminal signal target a type II membrane protein to the plant ER" ppsx

... CGGGGTACC CCATGACCGGAGCTAGCCGTCGGAGCGCGCGTGGTCGAATCAGTAAACGGAATCCGAAG FCNX11XYLT35 CGGGGTACC CCATGAATGATCGTAGACCGCAAAGGAAACGCCCAAGTAAACGGAATCCGAAG-3' RXYLT35 GGACTAGT TGAAAACGACGATGAGTG FXYLT35' GCTCTAGA GCATGAGTAAACGGAATCCG RXYLT35' ... CGGGGTACC CCATGAAATCATCATCATTATCTCCC FR/L4 CGGGGTACC CCATGACCGGAGCTAGCCTTCTGAGCGCGCTTGGTCTAATCAAATCATCA FR /A4 CGGGGTACC CCATGACCGGAGCTAGCGCTG...

Ngày tải lên: 12/08/2014, 03:21

... J, Takano T, Papillon J, Khadir A & Cybulsky AV (2001) Cytosolic phospholipase A2 -alpha associates with plasma membrane, endoplasmic reticulum and nuclear membrane in glomerular epithelial ... may function together at a distinct and novel compartment for eicosanoid signalling. Abbreviations Con A, concanavalin A; COX, cyclooxygenase; cPLA 2 -a, cytosolic phospholipase...

Ngày tải lên: 16/03/2014, 18:20

... florette.treurnicht@uct.ac.za; Koleka Mlisana - mlisanak@ukzn.ac.za; Salim S Abdool Karim - karims1@ukzn.ac.za; Carolyn Williamson - carolyn.williamson@uct.ac.za; The CAPRISA 002 Acute Infection Study Team - caprisa@ukzn.ac.za * ... signals that were more similar to one another than to those detectable in other HIV-1 subtypes. This test clearly indi- cated that selection signals de...

Ngày tải lên: 12/08/2014, 04:21

... was to better understand the catalytic mechanism of RNase Sa2 and to account for the differences in catalytic activity between RNases Sa2 and Sa. On the basis of the crystal structures of RNase ... RNase Sa [31]. An R6 5A mutation in RNase Sa caused k cat to decrease by three orders of magnitude. Because Arg65 in RNase Sa is structurally equivalent to Arg67 in RNase Sa2, and...

Ngày tải lên: 18/02/2014, 11:20

... Tsurumi, Yokohama 230-0045, Japan Database The atomic coordinates and the structure factors have been deposited in the Protein Data Bank (ID 2ZUE for the ternary complex of ArgRS, tRNA Arg CCU and ANP, and ... synthesized Arg-AMP to tRNA, the facts that the K m values for the cognate amino acids in the aminoacylation reaction on ArgRS, GlnRS and GluRS are not the same as...

Ngày tải lên: 18/02/2014, 11:20

... TTG ATG AGC CTA CCA (atr sense) This study atr2 TGC TGA TGA TGG CAA CTC (atr antisense) This study asd1 AAG CCG ATG ACA CCA ATT (asd sense) This study asd2 GCA GGT TCA TAG TGC ATG (asd antisense) ... O35ElpxL, the colonies on the chocolate agar plates were similar to those of the parental strain, and the growth rate in BHI broth in logarithmic phase was also similar to that of th...

Ngày tải lên: 18/02/2014, 14:20

... using the MluI ⁄ XhoI tailed primers DARSfw (5¢-ACTACGCGTAGTCCAAGAGAGGAGAAACC -3¢) and DARSrv (5¢-ACTCTCGAGCCCGGAGCGCTGGCG GCCGC-3¢), and NFKBIAfw (5¢-ACTGAGCTCCCGA CGACCCCAATTCAAATCG-3¢) and NFKBIArv ... of transcriptome data available in databases can be used to strongly enhance the prediction of transcription factor targets for cases in which targeted microarray experiments are not a...

Ngày tải lên: 18/02/2014, 18:20

... & Walborg EF Jr (1983) Characterization of a family of glycoproteins associated with the bile canalicu- lar membrane of normal hepatocytes but not expressed by two transplantable rat hepatocellular ... DPP IV has shown that the luminal domain of DPP IV carries dominant apical sorting information while the short cytoplasmic tail and the transmembrane domain contain competin...

Ngày tải lên: 19/02/2014, 07:20

... increasing the pH slightly to a value of 7.3 dramatically altered the effect of phosphate and activation was seen only at low concentrations with a maximal 1.7-fold activation at 2 mm phosphate. At Table ... temperature so that the pH at 5 °C was 7.5 and the pH at 37 °C was 7.2. The concentration of F6P was held at 0.5 m M. All other assay conditions are detailed in the Ma...

Ngày tải lên: 19/02/2014, 16:20

... The Association for Machine Transla- tion in the Americas. David Chiang. 2005. A hierarchical phrase-based model for statistical machine translation. In The Annual Con- ference of the Association ... generative baselines on several evaluation metrics and achieves the same perfor- mance as state-of -the- art discriminative classifiers specifically trained on several types of negative...

Ngày tải lên: 19/02/2014, 19:20