báo cáo khoa học: " Identification of flowering genes in strawberry, a perennial SD plant" potx
... AGAGCTTTCCTCTGGGAGAGA AP1 CGCTCCAGAAGAAGGATAAGG CATGTGACTGAGCCTGTGCT AP1 TCTGAAGCACGTAAGGTCTA ATCCTGATCATAACCTCCAG LHY AAAGCTGGAGAAGGAGGCAGTC CCGAGGATAAGGATTGCTTGGT ZTL TGCATGGGGTAGTGAAACAA CACCTCCGACAGTGACCTTT FKF1 ... CCTCACAATCATCCACCAATCC CGCCGATGTTGATCACCAA GA2ox CACCATGCCCAGAGCTTCA AGGCCAGAGGTGTTGTTGGAT TFL1 TGCAGAAACAAACGAGTTCGG CCAAGAGCATCGATCATTTGGT AP2 CCCGAAATCCTTGATTGTTCC AACACTGC...
Ngày tải lên: 12/08/2014, 03:21
... Relative quantification of maternal and paternal trans cripts for ATCDC48 in Arabidopsis thaliana F1 hybrid seeds (4 dap). Transcript expression levels of maternal and paternal alleles of ATCDC48 ... protein At1g16730 Unknown protein At1g17840 ABC transporter family protein At1g31820 Amino acid permease family protein At1g54710 AtATG18 At1g55320 Ligase, similar to acyl-activating enzy...
Ngày tải lên: 11/08/2014, 11:21
... gadi. References 1. Arai, H. P. Acanthocephala. In Guide to the parasites of fishes of Canada. Prat III, L. Margolis and Z. Kabata (eds.). Canadian Special Publication of Fisheries and Aquitic Sciences ... the length, and width of the body and internal organs were measured. Species identification was made according to Van Cleave [9] and Yamaguti [11] classification of the acant...
Ngày tải lên: 07/08/2014, 15:20
Báo cáo y học: " Identification of fusion genes in breast cancer by paired-end RNA-sequencing" potx
... Chen G, Cao Q, Han B, Dhanasekaran SM, Ponnala R, Cao X, Varambally S, Thomas DG, Giordano TJ, Beer DG, Palanisamy N, Sartor MA, Omenn GS, Chinnaiyan AM: An integrative approach to reveal driver ... ligation, SLX_PE_Adapter1_ds 5’[Phos]GATCGGAAGAGCGGT- TCAGCAGGAATGCCGA*G, SLX_PE_Adapter1_us 5 A* CACTCTTTCCCTACACGACGCTCTTCCGATCT; PCR library, SLX_P E_PCR_Primer1f 5’ A* ATGA- TACGGCGA CCACCGAG...
Ngày tải lên: 09/08/2014, 22:23
Báo cáo khoa học: Biosynthesis of D-arabinose in mycobacteria – a novel bacterial pathway with implications for antimycobacterial therapy pdf
... consists of an inner linear region of Araf-(1 fi 5) -a- Araf and of branched non-reducing terminal Ara6 motifs: Arafb1 fi 2Arafa1 fi 5 (A rafb1 fi 2Arafa1 fi 3)Arafa1 fi 5Arafa1. About two-thirds of the terminal ... pep- tidoglycan, d-arabinofuranose (Araf)-containing arabi- nogalactan and arabinomannan polysaccharides, mannans, glucans, long-chain (C 70 –C 90 ) a- branched, b-hydroxy fat...
Ngày tải lên: 30/03/2014, 04:20
Báo cáo khoa học: "characterization of phosphorus fractions in natural and fertilized forest soils" potx
... that an increase of the rainfall causes a decrease of the quality of SOM as a consequence of decreasing the pH and increas- ing of free Al. Then, at least two factors, MAP and SOM quality affecting ... superphosphate at 100 kg P ha –1 in April 1992. Some climatic and edaphic data are given in tables I and II. The climate of the area is characterized by rainy autumn and s...
Ngày tải lên: 08/08/2014, 14:21
báo cáo khoa học: " Identification of differentially expressed genes induced by Bamboo mosaic virus infection in Nicotiana benthamiana by cDNA-amplified fragment length polymorphism" pps
... ACCT8-1, ACCT2-1, and ACCT13. The forward primers are (5 ’GA ACAAAAAAATG- GAGTTTTA3’), (5’CGAACTCCCAACTGGCTTTC3’ ), (5’CTCTG GAAAGGAGAGCAATGTC3’), and (5’GAAC GCTTTGATGAGAATAGAGA3’) and the reverse ... pairs for ACAG1 (forward, 5’GAGAAAAT- GAAGGAGAAGGCCC3’ ; reverse, 5’ GCT CTGCCTT CTTCAATTGCTTCTT3’ ) and AC AG8 (forward, 5’GAAGGAAGCTGTGAATGTGTCA3’; reverse, 5’TGG TTAAGTTCATACGGAAAGA3’) were...
Ngày tải lên: 11/08/2014, 11:21
báo cáo khoa học: " Identification of miRNAs and their target genes in developing soybean seeds by deep sequencing" doc
... electrophoresis. RLM-5’ RACE Total RNA (200 μg) from soybean seeds was used to purify mRNA using the Oligotex kit (Qiagen). 5’ RNA adaptor (5’ -CGACUGGAGCACGAGGACACUGA- CAUGGACUGAAGGAGUAGAAA-3’ ) was ligated to the ... SBS sequencing. The small RNA library and degradome library sequen- cing data were available under NCBI-GEO accession no. GSE25260. Bioinformatic analysis of sequencing data...
Ngày tải lên: 11/08/2014, 11:21
báo cáo khoa học: " Identification of drought-response genes and a study of their expression during sucrose accumulation and water deficit in sugarcane culms" potx
... Imai A, Matsuyama T, Hanzawa Y, Akiyama T, Tamaoki M, Saji H, Shirano Y, Kato T, Hayashi H, Shibata D, Tabata S, Komeda Y, Takahashi T: Spermidine synthase genes are essential for survival of Arabidopsis. ... resulting in an approximately seven- fold increase in the total amino acid content. The expression of the AS gene, encoding a transaminase responsible for the synthesis of...
Ngày tải lên: 11/08/2014, 11:21
báo cáo khoa học: " Identification of rhizome-specific genes by genome-wide differential expression Analysis in Oryza longistaminata" doc
... jasmonate-mediated activation of the PDF1.2 gene of Arabidopsis. Plant Physiol 2003, 132:1020-1032. 46. Maruyama-Nakashita A, Nakamura Y, Watanabe-Takahashi A, Inoue E, Yamaya T, Takahashi H: Identification of ... ASYMMETRIC LEAVES2 gene of Arabidopsis thaliana, required for formation of a symmetric flat leaf lamina, encodes a member of a novel family of proteins chara...
Ngày tải lên: 11/08/2014, 11:21