báo cáo khoa học: " A modified TILLING approach to detect induced mutations in tetraploid and hexaploid wheat" pptx
báo cáo khoa học: " A modified TILLING approach to detect induced mutations in tetraploid and hexaploid wheat" pptx
... ATTTACCCGCAGGTAAATTTAAAGCTTCAGTATTATGAAGCGCCTCCACTAGTCTACTTGCATATCTTACAAGAAAATTTATAATTCCTGTTTTCGCCTCTCTTTTTTCCA
B genome ATTTACCCGCAGGTAAATTTAAAGCTTTACTATGA AACGCCTCCACTAGTCTAATTGCATATCTTATAAGAAAATTTATAATTCCTGTTTTCCCCTCTCTTTTTTCCA
D genome ATTTACCCGCAGGTAAATTTAAAGCTTTATTATTATGAAACGCCTCCACTAGTCTAATTGCATATCTTATAAGAAAATTTATAATTCCTGTTTTCCCCTCTCTTTTTTCCA
A
B
A ... ATTTACCCGCAGGTAAATTTAAAGCTTTA...
Tài liệu Báo cáo khoa học: "A Feature Based Approach to Leveraging Context for Classifying Newsgroup Style Discussion Segments" pptx
... providing indicators of the qual-
ity of group functioning and argumentation.
Lacson and colleagues (2006) describe a form of
conversation summarization where a classification
approach is ... the quality of interactions in that context is to
enable the quality and nature of discussions that
occur within an on-line discussion board to be
communicated in a summary to...
Báo cáo khoa học: "A multi-staged approach to identifying complex events in textual data" ppt
... possible facets.
Another key characteristic of rich domains
like financial analysis, is that facts and events are
subject to interpretation in context. To a finan-
cial analyst, it makes a difference ... etc.
133
Maytag: A multi-staged approach to identifying
complex events in textual data
Conrad Chang, Lisa Ferro, John Gibson, Janet Hitzeman, Suzi Lubar, Justin Palmer,
Se...
Báo cáo khoa học: "A Unification-based Approach to Morpho-syntactic Parsing of Agglutinative and Other (Highly) Inflectional Languages" doc
... morphological analysis - otherwise
several billions of word forms would have to be
included in a single database. Thus stemming is a
combination of the morphological analysis and a
post-processing ... (almost) automatically. The lexical basis
of Humor 99 contains surface characters only -
no transformations are applied -, while the meta-
dictionary mechanism retains many ad...
Báo cáo khoa học: "A Unification-based Approach to Morpho-syntactic Parsing of Agglutinative and Other (Highly) Inflectional Languages" ppt
...
Subcat=Adj
Deriv=Adv
Allom=i
Lex=NonBase
Base
0
i ->__.y
cate~or~
[ADJ]
[ADH
[ADV]
way of handling compounding and adequate han-
dling of derivational affixes.
Recent implementations ... unification-based approach introduced
in the morphological analyzer. This means that
all atomic elements in a phrase pattern have three
feature structures; two for the concatenati...
Tài liệu Báo cáo khoa học: "A Ranking-based Approach to Word Reordering for Statistical Machine Translation" doc
... a pre-reordering based
SMT system, but also be integrated into a phrase-
based decoder serving as additional distortion fea-
tures.
We evaluated our approach on large-scale
Japanese-English and ... English-Japanese machine
translation tasks, and experimental results show that
our approach can bring significant improvements to
the baseline phrase-based SMT system in both pre-
or...
Tài liệu Báo cáo khoa học: "A Fully Bayesian Approach to Unsupervised Part-of-Speech Tagging∗" docx
... entire data
set. The algorithm was initialized with a random tag
assignment and a temperature of 2, and the temper-
ature was gradually decreased to .08. Since our in-
ference procedure is stochastic, ... average number of tags per token being 2.3.
We varied the values of the hyperparameters α and
β and evaluated overall tagging accuracy. For com-
parison with our Bayesian HMM...
Báo cáo khoa học: "A Nonparametric Bayesian Approach to Acoustic Model Discovery" docx
... Computational Linguistics
A Nonparametric Bayesian Approach to Acoustic Model Discovery
Chia-ying Lee and James Glass
Computer Science and Artificial Intelligence Laboratory
Massachusetts Institute ... Timit acoustic-
phonetic continuous speech corpus.
Andrew Gelman, John B. Carlin, Hal S. Stern, and Don-
ald B. Rubin. 2004. Bayesian Data Analysis. Texts
in Statistical Science. C...
Báo cáo khoa học: "A Two-step Approach to Sentence Compression of Spoken Utterances" pdf
... (Cohn and La-
pata, 2008) expands the operation set by including
insertion, substitution and reordering, and incorpo-
rates grammar rules. In speech domain, (Clarke and
Lapata, 2008) investigates ... compression in
broadcast news using an integer linear programming
approach. There is only a few existing work in spon-
taneous speech domains. (Liu and Liu, 2010) mod-
eled it...
Báo cáo khoa học: "A Syntax-Free Approach to Japanese Sentence Compression" potx
... sentence
compression: A comparison across domains, train-
ing requirements and evaluation measures. In Proc.
of the 21st COLING and 44th ACL, pages 377–384.
C. Hori and S. Furui. 2003. A new approach to auto-
matic ... 2007;
Hori and Furui, 2003; Clarke and Lapata, 2006).
Nomoto (2007) and McDonald (2006) employed
the random field based approach. Hori et al.
(2003) and...