báo cáo khoa học: " A modified TILLING approach to detect induced mutations in tetraploid and hexaploid wheat" pptx

báo cáo khoa học: " A modified TILLING approach to detect induced mutations in tetraploid and hexaploid wheat" pptx

báo cáo khoa học: " A modified TILLING approach to detect induced mutations in tetraploid and hexaploid wheat" pptx

... ATTTACCCGCAGGTAAATTTAAAGCTTCAGTATTATGAAGCGCCTCCACTAGTCTACTTGCATATCTTACAAGAAAATTTATAATTCCTGTTTTCGCCTCTCTTTTTTCCA B genome ATTTACCCGCAGGTAAATTTAAAGCTTTACTATGA AACGCCTCCACTAGTCTAATTGCATATCTTATAAGAAAATTTATAATTCCTGTTTTCCCCTCTCTTTTTTCCA D genome ATTTACCCGCAGGTAAATTTAAAGCTTTATTATTATGAAACGCCTCCACTAGTCTAATTGCATATCTTATAAGAAAATTTATAATTCCTGTTTTCCCCTCTCTTTTTTCCA A B A ... ATTTACCCGCAGGTAAATTTAAAGCTTTA...

Ngày tải lên: 12/08/2014, 03:21

14 324 0
Tài liệu Báo cáo khoa học: "A Feature Based Approach to Leveraging Context for Classifying Newsgroup Style Discussion Segments" pptx

Tài liệu Báo cáo khoa học: "A Feature Based Approach to Leveraging Context for Classifying Newsgroup Style Discussion Segments" pptx

... providing indicators of the qual- ity of group functioning and argumentation. Lacson and colleagues (2006) describe a form of conversation summarization where a classification approach is ... the quality of interactions in that context is to enable the quality and nature of discussions that occur within an on-line discussion board to be communicated in a summary to...

Ngày tải lên: 20/02/2014, 12:20

4 519 0
Báo cáo khoa học: "A multi-staged approach to identifying complex events in textual data" ppt

Báo cáo khoa học: "A multi-staged approach to identifying complex events in textual data" ppt

... possible facets. Another key characteristic of rich domains like financial analysis, is that facts and events are subject to interpretation in context. To a finan- cial analyst, it makes a difference ... etc. 133 Maytag: A multi-staged approach to identifying complex events in textual data Conrad Chang, Lisa Ferro, John Gibson, Janet Hitzeman, Suzi Lubar, Justin Palmer, Se...

Ngày tải lên: 08/03/2014, 21:20

4 404 0
Báo cáo khoa học: "A Unification-based Approach to Morpho-syntactic Parsing of Agglutinative and Other (Highly) Inflectional Languages" doc

Báo cáo khoa học: "A Unification-based Approach to Morpho-syntactic Parsing of Agglutinative and Other (Highly) Inflectional Languages" doc

... morphological analysis - otherwise several billions of word forms would have to be included in a single database. Thus stemming is a combination of the morphological analysis and a post-processing ... (almost) automatically. The lexical basis of Humor 99 contains surface characters only - no transformations are applied -, while the meta- dictionary mechanism retains many ad...

Ngày tải lên: 23/03/2014, 19:20

8 404 0
Báo cáo khoa học: "A Unification-based Approach to Morpho-syntactic Parsing of Agglutinative and Other (Highly) Inflectional Languages" ppt

Báo cáo khoa học: "A Unification-based Approach to Morpho-syntactic Parsing of Agglutinative and Other (Highly) Inflectional Languages" ppt

... Subcat=Adj Deriv=Adv Allom=i Lex=NonBase Base 0 i ->__.y cate~or~ [ADJ] [ADH [ADV] way of handling compounding and adequate han- dling of derivational affixes. Recent implementations ... unification-based approach introduced in the morphological analyzer. This means that all atomic elements in a phrase pattern have three feature structures; two for the concatenati...

Ngày tải lên: 23/03/2014, 19:20

8 413 0
Tài liệu Báo cáo khoa học: "A Ranking-based Approach to Word Reordering for Statistical Machine Translation" doc

Tài liệu Báo cáo khoa học: "A Ranking-based Approach to Word Reordering for Statistical Machine Translation" doc

... a pre-reordering based SMT system, but also be integrated into a phrase- based decoder serving as additional distortion fea- tures. We evaluated our approach on large-scale Japanese-English and ... English-Japanese machine translation tasks, and experimental results show that our approach can bring significant improvements to the baseline phrase-based SMT system in both pre- or...

Ngày tải lên: 19/02/2014, 19:20

9 616 0
Tài liệu Báo cáo khoa học: "A Fully Bayesian Approach to Unsupervised Part-of-Speech Tagging∗" docx

Tài liệu Báo cáo khoa học: "A Fully Bayesian Approach to Unsupervised Part-of-Speech Tagging∗" docx

... entire data set. The algorithm was initialized with a random tag assignment and a temperature of 2, and the temper- ature was gradually decreased to .08. Since our in- ference procedure is stochastic, ... average number of tags per token being 2.3. We varied the values of the hyperparameters α and β and evaluated overall tagging accuracy. For com- parison with our Bayesian HMM...

Ngày tải lên: 20/02/2014, 12:20

8 524 0
Báo cáo khoa học: "A Nonparametric Bayesian Approach to Acoustic Model Discovery" docx

Báo cáo khoa học: "A Nonparametric Bayesian Approach to Acoustic Model Discovery" docx

... Computational Linguistics A Nonparametric Bayesian Approach to Acoustic Model Discovery Chia-ying Lee and James Glass Computer Science and Artificial Intelligence Laboratory Massachusetts Institute ... Timit acoustic- phonetic continuous speech corpus. Andrew Gelman, John B. Carlin, Hal S. Stern, and Don- ald B. Rubin. 2004. Bayesian Data Analysis. Texts in Statistical Science. C...

Ngày tải lên: 07/03/2014, 18:20

10 478 0
Báo cáo khoa học: "A Two-step Approach to Sentence Compression of Spoken Utterances" pdf

Báo cáo khoa học: "A Two-step Approach to Sentence Compression of Spoken Utterances" pdf

... (Cohn and La- pata, 2008) expands the operation set by including insertion, substitution and reordering, and incorpo- rates grammar rules. In speech domain, (Clarke and Lapata, 2008) investigates ... compression in broadcast news using an integer linear programming approach. There is only a few existing work in spon- taneous speech domains. (Liu and Liu, 2010) mod- eled it...

Ngày tải lên: 07/03/2014, 18:20

5 426 1
Báo cáo khoa học: "A Syntax-Free Approach to Japanese Sentence Compression" potx

Báo cáo khoa học: "A Syntax-Free Approach to Japanese Sentence Compression" potx

... sentence compression: A comparison across domains, train- ing requirements and evaluation measures. In Proc. of the 21st COLING and 44th ACL, pages 377–384. C. Hori and S. Furui. 2003. A new approach to auto- matic ... 2007; Hori and Furui, 2003; Clarke and Lapata, 2006). Nomoto (2007) and McDonald (2006) employed the random field based approach. Hori et al. (2003) and...

Ngày tải lên: 08/03/2014, 00:20

8 464 0
w