báo cáo khoa học: " A modified TILLING approach to detect induced mutations in tetraploid and hexaploid wheat" pptx

... ATTTACCCGCAGGTAAATTTAAAGCTTCAGTATTATGAAGCGCCTCCACTAGTCTACTTGCATATCTTACAAGAAAATTTATAATTCCTGTTTTCGCCTCTCTTTTTTCCA B genome ATTTACCCGCAGGTAAATTTAAAGCTTTACTATGA AACGCCTCCACTAGTCTAATTGCATATCTTATAAGAAAATTTATAATTCCTGTTTTCCCCTCTCTTTTTTCCA D genome ATTTACCCGCAGGTAAATTTAAAGCTTTATTATTATGAAACGCCTCCACTAGTCTAATTGCATATCTTATAAGAAAATTTATAATTCCTGTTTTCCCCTCTCTTTTTTCCA A B A ... ATTTACCCGCAGGTAAATTTAAAGCTTTA...

Ngày tải lên: 12/08/2014, 03:21

... providing indicators of the qual- ity of group functioning and argumentation. Lacson and colleagues (2006) describe a form of conversation summarization where a classification approach is ... the quality of interactions in that context is to enable the quality and nature of discussions that occur within an on-line discussion board to be communicated in a summary to...

Ngày tải lên: 20/02/2014, 12:20

... possible facets. Another key characteristic of rich domains like financial analysis, is that facts and events are subject to interpretation in context. To a finan- cial analyst, it makes a difference ... etc. 133 Maytag: A multi-staged approach to identifying complex events in textual data Conrad Chang, Lisa Ferro, John Gibson, Janet Hitzeman, Suzi Lubar, Justin Palmer, Se...

Ngày tải lên: 08/03/2014, 21:20

... morphological analysis - otherwise several billions of word forms would have to be included in a single database. Thus stemming is a combination of the morphological analysis and a post-processing ... (almost) automatically. The lexical basis of Humor 99 contains surface characters only - no transformations are applied -, while the meta- dictionary mechanism retains many ad...

Ngày tải lên: 23/03/2014, 19:20

... Subcat=Adj Deriv=Adv Allom=i Lex=NonBase Base 0 i ->__.y cate~or~ [ADJ] [ADH [ADV] way of handling compounding and adequate han- dling of derivational affixes. Recent implementations ... unification-based approach introduced in the morphological analyzer. This means that all atomic elements in a phrase pattern have three feature structures; two for the concatenati...

Ngày tải lên: 23/03/2014, 19:20

... a pre-reordering based SMT system, but also be integrated into a phrase- based decoder serving as additional distortion fea- tures. We evaluated our approach on large-scale Japanese-English and ... English-Japanese machine translation tasks, and experimental results show that our approach can bring significant improvements to the baseline phrase-based SMT system in both pre- or...

Ngày tải lên: 19/02/2014, 19:20

... entire data set. The algorithm was initialized with a random tag assignment and a temperature of 2, and the temper- ature was gradually decreased to .08. Since our in- ference procedure is stochastic, ... average number of tags per token being 2.3. We varied the values of the hyperparameters α and β and evaluated overall tagging accuracy. For com- parison with our Bayesian HMM...

Ngày tải lên: 20/02/2014, 12:20

... Computational Linguistics A Nonparametric Bayesian Approach to Acoustic Model Discovery Chia-ying Lee and James Glass Computer Science and Artificial Intelligence Laboratory Massachusetts Institute ... Timit acoustic- phonetic continuous speech corpus. Andrew Gelman, John B. Carlin, Hal S. Stern, and Don- ald B. Rubin. 2004. Bayesian Data Analysis. Texts in Statistical Science. C...

Ngày tải lên: 07/03/2014, 18:20

... (Cohn and La- pata, 2008) expands the operation set by including insertion, substitution and reordering, and incorpo- rates grammar rules. In speech domain, (Clarke and Lapata, 2008) investigates ... compression in broadcast news using an integer linear programming approach. There is only a few existing work in spon- taneous speech domains. (Liu and Liu, 2010) mod- eled it...

Ngày tải lên: 07/03/2014, 18:20

... sentence compression: A comparison across domains, train- ing requirements and evaluation measures. In Proc. of the 21st COLING and 44th ACL, pages 377–384. C. Hori and S. Furui. 2003. A new approach to auto- matic ... 2007; Hori and Furui, 2003; Clarke and Lapata, 2006). Nomoto (2007) and McDonald (2006) employed the random field based approach. Hori et al. (2003) and...

Ngày tải lên: 08/03/2014, 00:20