báo cáo khoa học: " Recovery and characterization of a Citrus clementina Hort ex Tan ''''''''Clemenules'''''''' haploid plant selected to establish the reference whole Citrus genome sequence" pot

báo cáo khoa học: " Recovery and characterization of a Citrus clementina Hort. ex Tan. ''''Clemenules'''' haploid plant selected to establish the reference whole Citrus genome sequence" pot

báo cáo khoa học: " Recovery and characterization of a Citrus clementina Hort. ex Tan. ''''Clemenules'''' haploid plant selected to establish the reference whole Citrus genome sequence" pot

... 2.3 and 4.6 cm. The max- imum value of the haploid plants was similar to the leaf length of the aneuploid plant (4.4 cm). Histological characterization The histological structure of anthers of the ... Biology Open Access Research article Recovery and characterization of a Citrus clementina Hort. ex Tan. 'Clemenules' haploid plant...

Ngày tải lên: 12/08/2014, 03:21

17 196 0
Tài liệu Báo cáo khoa học: Production and characterization of a secreted, C-terminally processed tyrosinase from the filamentous fungus Trichoderma reesei ppt

Tài liệu Báo cáo khoa học: Production and characterization of a secreted, C-terminally processed tyrosinase from the filamentous fungus Trichoderma reesei ppt

... ATT CCA TCA TCA TCA TCA TCA TCA GGG CAC GAC ACA CAT CCC C; and reverse primer, GAT CGG TAC CTC ATT ACA GAG GAG GGA TAT GGG GAA C. The PCR reaction was done as described above. The amplified PCR ... trypsin and the potential glycopeptides were bound to a ConA column. MALDI-TOF MS analysis of the eluted material revealed a few peptides, of which the largest had a molecu...

Ngày tải lên: 19/02/2014, 06:20

14 651 0
Báo cáo khoa học: Synthesis and characterization of a new and radiolabeled high-affinity substrate for H+/peptide cotransporters pdf

Báo cáo khoa học: Synthesis and characterization of a new and radiolabeled high-affinity substrate for H+/peptide cotransporters pdf

... was subtracted from the total uptake to calculate the carrier-mediated uptake. Inset: Eadie–Hofstee transformation of the specific Gly-Sar uptake data [S, Gly-Sar concentration (m M); v, uptake ... incubation periods from 10 min up to 8 h. The amount of Bip-Pro in the extracellular uptake medium was quantified according to the laboratory standard HPLC (La-Chrom Ò ; Merck-H...

Ngày tải lên: 07/03/2014, 05:20

10 490 0
Báo cáo khoa học: Discovery and characterization of a Coenzyme A disulfide reductase from Pyrococcus horikoshii Implications for the disulfide metabolism of anaerobic hyperthermophiles doc

Báo cáo khoa học: Discovery and characterization of a Coenzyme A disulfide reductase from Pyrococcus horikoshii Implications for the disulfide metabolism of anaerobic hyperthermophiles doc

... the P. horikoshii CoADR), and TG104 (5¢-CGCGCCATGGAAAAGAAAAAGGTA GTCATAA-3¢) and TG105 (5¢-CGCGGTCGACCTAGAA CTTCAAAACCCTGGC-3¢) for the P. furiosus CoADR. The N terminus of the CoADRs were based ... lL. Oxidation of NAD(P)H was monitored at 340 nm. The standard oxid- ase assay used to monitor the purification of phCoADR was conducted with 100 lm NADH and FAD as above....

Ngày tải lên: 07/03/2014, 17:20

12 420 0
Báo cáo khoa học: Production and characterization of a thermostable L-threonine dehydrogenase from the hyperthermophilic archaeon Pyrococcus furiosus docx

Báo cáo khoa học: Production and characterization of a thermostable L-threonine dehydrogenase from the hyperthermophilic archaeon Pyrococcus furiosus docx

... was PCR amplified from chromosomal DNA of P. furiosus using the primers BG1279 (5¢-GCGCG CCATGGCATCCGAGAAGATGGTTGCTATCA, sense) and BG1297 (5¢-GCGCG GGATCCTCATTTAAGCAT GAAAACAACTTTGCC, antisense), ... the initial activity of Pf-TDH was checked using butane- 2,3-diol as substrate in the standard oxidation reaction and acetoin in the reduction reaction. The activity of Pf-TDH...

Ngày tải lên: 16/03/2014, 14:20

8 415 0
Báo cáo khoa học: Isolation and characterization of a D-cysteine desulfhydrase protein from Arabidopsis thaliana pptx

Báo cáo khoa học: Isolation and characterization of a D-cysteine desulfhydrase protein from Arabidopsis thaliana pptx

... pots, and all plant tissue above ground was used for the analyses. (A) Total RNA was extracted and 20 lg RNA was loaded in each lane and blotted as indicated in Experimental procedures. To prove ... Nagasawa T, Ohkishi H, Kawakami B, Yamano H, Hosono H, Tani Y & Yamada H (1982) 3-chloro-d-ala- nine chloride-lyase (deaminating) of Pseudomonas putida CR 1–1. Purification and...

Ngày tải lên: 16/03/2014, 18:20

14 565 0
Báo cáo khoa học: Production and characterization of a noncytotoxic deletion variant of the Aspergillus fumigatus allergen Aspf1 displaying reduced IgE binding ppt

Báo cáo khoa học: Production and characterization of a noncytotoxic deletion variant of the Aspergillus fumigatus allergen Aspf1 displaying reduced IgE binding ppt

... (5¢-GTCGTCTTGCGGTCACCT GGACATGCATCAACGAACAG-3¢) and Ct-Aspf1 (5¢-GT CGTCTTGGATCCTCTCGAGTCTCAATGAGAACACA GTCTCAAGTC-3¢). These primers contained BstEII and BamHI sites and were used to generate a fragment that was cloned in the same ... proteins as inhibitors: Aspf1, Aspf1D(7– 22), a- sarcin and a- sarcin D(7–22). The inhibitor amount is plotted in logarithmic scale. The st...

Ngày tải lên: 16/03/2014, 19:20

9 517 0
Báo cáo khoa học: Detection and characterization of a novel extracellular fungal enzyme that catalyzes the specific and hydrolytic cleavage of lignin guaiacylglycerol b-aryl ether linkages pdf

Báo cáo khoa học: Detection and characterization of a novel extracellular fungal enzyme that catalyzes the specific and hydrolytic cleavage of lignin guaiacylglycerol b-aryl ether linkages pdf

... Ikeda 1 , Shinya Kajita 1 , Masaya Nakamura 2 and Yoshihiro Katayama 1 1 Graduate School of Bio-Applications and Systems Engineering, Tokyo University of Agriculture and Technology, Koganei, Tokyo, Japan; 2 Forestry ... large excess of water was added and the resultant precipitate was collected as DHP-GOU. Isolation of the fungi and enzyme Activity of the b-aryl ethe...

Ngày tải lên: 17/03/2014, 03:20

10 671 0
Báo cáo khoa hoc:" Construction and characterization of a bovine BAC library with four genome-equivalent coverage" pptx

Báo cáo khoa hoc:" Construction and characterization of a bovine BAC library with four genome-equivalent coverage" pptx

... characterization of a bovine BAC library with four genome- equivalent coverage André E GGEN a, ∗ , Mathieu G AUTIER a , Alain B ILLAUT d , Élisabeth P ETIT a , Hélène H AYES a , Pascal L AURENT a , Catherine ... or so BAC clones analysed by FISH was chimeric. This BAC library increases the international genome coverage for cattle to around 28 genome equivalents and e...

Ngày tải lên: 09/08/2014, 18:21

6 271 0
báo cáo khoa học: " Cloning and characterization of a glucosyltransferase from Crocus sativus stigmas involved in flavonoid glucosylation" pdf

báo cáo khoa học: " Cloning and characterization of a glucosyltransferase from Crocus sativus stigmas involved in flavonoid glucosylation" pdf

... complexes in the phe- nylpropanoid and flavonoid pathways. Physiol Plant 1999, 107:142-149. 59. Nakatsuka T, Sato K, Takahashi H, Yamamura S, Nishihara M: Clon- ing and characterization of the ... before anthesis (-2da), anthesis (da), one day after anthesis (+1da), and three days after anthesis (+3da), and in closed and open stamen (st c and st o ), corm, tepals (pt)...

Ngày tải lên: 12/08/2014, 03:21

16 359 0
w