báo cáo khoa học: " Targeted isolation, sequence assembly and characterization of two white spruce (Picea glauca) BAC clones for terpenoid synthase and cytochrome P450 genes involved in conifer defence reveal insights into a conifer genome" pdf
... orientation) were designed based on the sequence scaffolds of PGB02 (AATTGGTCAATTC- CTAAAACACCATG, AAATTATGGGTTTTAAGGGCTA- GAGTTC) and PGB04 (AACAAATTTACTCATTTA CCCGTGA, CCCATCAAAATCCATGCCCAAG, ... and characterization of two white spruce (Picea glauca) BAC clones for terpenoid synthase and cytochrome P450 genes involved in conifer defence re...
Ngày tải lên: 12/08/2014, 03:21
... RNA (5¢-cggagaugacgg-3¢), 29 base DNA 13 -RNA 4 - DNA 12 (5¢-AATAGAGAAAAAGaaaaAAGATGGCAA AG-3¢), 29 base DNA 15 -RNA 1 -DNA 13 (5¢-AATAGAGAA AAAGAAaAAAGATGGCAAAG-3¢) and 3¢-FAM-labeled 18 base ... PCR primers are 5¢- TGGGTTTGAGAG CATATGAAGTTGG CAAAAAAATACTAC-3¢ for primer 1, 5¢-CG CATATG GAGACGATGATCGCCTACGTCGATG-3¢ for primer 2, 5¢-ACCGTT AAGCTTTCATAAACATCCTCCTTT-3¢ for primer 3, an...
Ngày tải lên: 06/03/2014, 22:21
Báo cáo khoa học: Glycolysis in Entamoeba histolytica Biochemical characterization of recombinant glycolytic enzymes and flux control analysis ppt
... establishing the kinetic constants at optimal and physiological pH values, analyzing the effect of activators and inhibitors, and investigating the storage stability and oligo- meric state. Determination ... fungi and some protozoans, whereas class I aldolases do not require a metal cofactor and are present in bacteria, protozoa, animal and plant cells [34]. This analysis...
Ngày tải lên: 07/03/2014, 17:20
Báo cáo khoa học: Catalytically active membrane-distal phosphatase domain of receptor protein-tyrosine phosphatase a is required for Src activation doc
... function of RPTPa, impairing Src binding and its ability to activate Src. Our results indicate that a catalytically active D2 domain is required for RPTP a- mediated Src binding and activation. We ... substrate, Src, and to dephosphorylate and activate it. Materials and methods Materials and antibodies Anti-HA-tag (12CA5), anti-Src (327) Igs and anti-RPTPa (5478AP) serum...
Ngày tải lên: 15/03/2014, 10:20
Báo cáo khoa học: Quenched hydrogen ⁄deuterium exchange NMR characterization of amyloid-b peptide aggregates formed in the presence of Cu2+ or Zn2+ ppt
... Cu 2+ [(iii) and (iv)], Zn 2+ [(i) and (ii)] or EDTA [(v) and (vi)] and continued for 164 min. After 100 min, 400 lM EDTA was added, and the absorbance was measured for an additional 64 min. (B) ThT analysis ... Y, Tanemura K, Murayama O, Akagi T, Murayama M, Sato S, Sun X, Tanaka N & Takashima A (2001) New insights on how metals disrupt amyloid beta-aggregation and th...
Ngày tải lên: 30/03/2014, 01:20
Báo cáo khoa học: "Review article Heat Resistance in Liquids of Enterococcus spp., Listeria spp., Escherichia coli, Yersinia enterocolitica, Salmonella spp. and Campylobacter spp" ppt
... Recovery of heat-treated bacteria In the great majority of cases the recovery of heat-treated bacteria was performed on agar plates. Enterococci and E. coli were incubated aerobically at 30-37°C for ... means of D values and on predicted individual D values were also cal- culated. Lines and values are shown in figures and tables. Differences in heat resistance noted be...
Ngày tải lên: 12/08/2014, 15:20
Tài liệu Báo cáo khoa học: Evidence that the assembly of the yeast cytochrome bc1 complex involves the formation of a large core structure in the inner mitochondrial membrane pdf
... mitochon- drial respiratory chain, the assistance of specific chaperone proteins is also required. The available data indicate that the accessory factor Bcs1p is involved in the binding of ISP to an immature ... apoferritin (440 kDa), catalase (230 kDa), alcohol dehydrogenase (150 kDa), con- albumin (78 kDa), albumin (66 kDa), and b-lactoglobulin (35 kDa). In the experiment testing...
Ngày tải lên: 18/02/2014, 08:20
Tài liệu Báo cáo khoa học: The isolation and characterization of cytochrome c nitrite reductase subunits (NrfA and NrfH) from Desulfovibrio desulfuricans ATCC 27774 Re-evaluation of the spectroscopic data and redox properties ppt
... remaining hemes and the dihedral angles of the axially coordinated His support this assignment (Fig. 7, interplanar angles in legend). The Mo ¨ ssbauer data reveals the presence of two low-spin ... desulfuricans ATCC 27774 Re-evaluation of the spectroscopic data and redox properties Maria Gabriela Almeida 1 , So a Macieira 2 , Luisa L. Gonc¸alves 1 , Robert Huber 2 , Carlos A....
Ngày tải lên: 21/02/2014, 00:20
Báo cáo khoa học: "Targeted Help for Spoken Dialogue Systems: intelligent feedback improves naive users'''' performance" pdf
... interaction, adaptation and styles of management, page (in press). Oliver Lemon, Anne Bracy, Alexander Gruenstein, and Stanley Peters. 2001. Information states in a multi- modal dialogue system for ... Place Edinburgh EH8 9LW, UK olemon@inf.ed.ac.uk Ellen Campana Laura Hiatt Gregory Aist Department of Brain Center for the Study of Language RIACS and Cognitive Sci...
Ngày tải lên: 08/03/2014, 21:20