báo cáo khoa học: " Targeted isolation, sequence assembly and characterization of two white spruce (Picea glauca) BAC clones for terpenoid synthase and cytochrome P450 genes involved in conifer defence reveal insights into a conifer genome" pdf
báo cáo khoa học: " Targeted isolation, sequence assembly and characterization of two white spruce (Picea glauca) BAC clones for terpenoid synthase and cytochrome P450 genes involved in conifer defence reveal insights into a conifer genome" pdf
... orientation) were designed based on the sequence scaffolds of PGB02 (AATTGGTCAATTC-CTAAAACACCATG, AAATTATGGGTTTTAAGGGCTA-GAGTTC) and PGB04 (AACAAATTTACTCATTTACCCGTGA, CCCATCAAAATCCATGCCCAAG, ... and characterization of two white spruce (Picea glauca) BAC clones for terpenoid synthase and cytochrome P450 genes involved in conifer defence reveal insights into a conifer genomeBjörn Hamberger1, ... contain a TCA-element atpositions -815 and -3,291 in PGB02 and at positions -1,227, -676 and -1,162 (TCAGAAGAGG, GAGAAGAATA and CAGAAAAGGA) in PGB04, respectively. This elementwas first characterised...
- 13
- 329
- 0
Báo cáo khoa học: The N-terminal hybrid binding domain of RNase HI from Thermotoga maritima is important for substrate binding and Mg2+-dependent activity pot
... RNA (5¢-cggagaugacgg-3¢), 29 base DNA13-RNA4-DNA12(5¢-AATAGAGAAAAAGaaaaAAGATGGCAAAG-3¢), 29 base DNA15-RNA1-DNA13(5¢-AATAGAGAAAAAGAAaAAAGATGGCAAAG-3¢) and 3¢-FAM-labeled18 base ... PCRprimers are 5¢- TGGGTTTGAGAGCATATGAAGTTGGCAAAAAAATACTAC-3¢ for primer 1, 5¢-CGCATATGGAGACGATGATCGCCTACGTCGATG-3¢ for primer 2,5¢-ACCGTTAAGCTTTCATAAACATCCTCCTTT-3¢ for primer 3, and 5¢-CGGAATTCTCATGTGTCCAGTTCTGGACAGATGCACTC-3¢ ... a three-stranded anti-parallel b-sheet (b1–b3) and two helices (aA and aB) [22]. It binds to the minor groove of the substrate, such that a loop between aA and b3interacts with the RNA backbone and a...
- 16
- 459
- 0
Báo cáo khoa học: Glycolysis in Entamoeba histolytica Biochemical characterization of recombinant glycolytic enzymes and flux control analysis ppt
... establishing the kineticconstants at optimal and physiological pH values, analyzing the effect of activators and inhibitors, and investigating the storage stability and oligo-meric state. Determination ... fungi and some protozoans, whereas class I aldolases do notrequire a metal cofactor and are present in bacteria,protozoa, animal and plant cells [34]. This analysis[26] indicates that EhALDO ... (with ATP-PFK instead of PPi-PFK and PYK instead of PPDK). At pH 6.0,the Vmaxvalues of amoebal PGAM and PPDKshowed a slight increase, those of HK, HPI, TPI and ENO were relatively unchanged, and...
- 17
- 589
- 0
Báo cáo khoa học: Catalytically active membrane-distal phosphatase domain of receptor protein-tyrosine phosphatase a is required for Src activation doc
... function of RPTPa, impairing Src binding and its ability to activate Src. Our results indicate that a catalytically active D2 domain is required for RPTP a- mediated Src binding and activation.We ... substrate, Src, and to dephosphorylate and activate it.Materials and methodsMaterials and antibodiesAnti-HA-tag (12CA5), anti-Src (327) Igs and anti-RPTPa(5478AP) serum were prepared as previously ... domains. The membrane-proximal catalytic domain (D1) and the membrane-distal phosphatase domain (D2) of RPTPs are highlyconserved, in that the D2 domains contain a protein-tyrosine phosphatase...
- 9
- 289
- 0
Báo cáo khoa học: Quenched hydrogen ⁄deuterium exchange NMR characterization of amyloid-b peptide aggregates formed in the presence of Cu2+ or Zn2+ ppt
... Cu2+[(iii) and (iv)], Zn2+[(i) and (ii)] or EDTA [(v) and (vi)] and continued for 164 min. After 100 min, 400 lM EDTA was added, and the absorbance wasmeasured for an additional 64 min. (B) ThT analysis ... Y, Tanemura K, Murayama O, Akagi T,Murayama M, Sato S, Sun X, Tanaka N & Takashima A (2001) New insights on how metals disrupt amyloidbeta-aggregation and their effects on amyloid-betacytotoxicity. ... pitch of 0.5 nm, and a scan rate of 20 nmÆs)1, in a 2 mm quartz cuvette.AFM A portion of each Ab aggregate sample was diluted in water to approximately 1 lm peptide and applied to freshlycleaved...
- 10
- 294
- 0
Báo cáo khoa học: "Review article Heat Resistance in Liquids of Enterococcus spp., Listeria spp., Escherichia coli, Yersinia enterocolitica, Salmonella spp. and Campylobacter spp" ppt
... Recovery of heat-treated bacteria In the great majority of cases the recovery of heat-treated bacteria was performed on agarplates. Enterococci and E. coli were incubatedaerobically at 30-37°C for ... means of D values and on predicted individual D values were also cal-culated. Lines and values are shown in figures and tables. Differences in heat resistancenoted between and within the bacterial ... summary in English). Rowan NJ, Anderson JG: Effects of above-optimumHeat resistance of bacteria 17Acta vet. scand. vol. 44 no. 1-2, 2003Types of collected data and statistical analysisD and...
- 19
- 242
- 0
Tài liệu Báo cáo khoa học: Evidence that the assembly of the yeast cytochrome bc1 complex involves the formation of a large core structure in the inner mitochondrial membrane pdf
... mitochon-drial respiratory chain, the assistance of specificchaperone proteins is also required. The available dataindicate that the accessory factor Bcs1p is involved in the binding of ISP to an immature ... apoferritin (440 kDa),catalase (230 kDa), alcohol dehydrogenase (150 kDa), con-albumin (78 kDa), albumin (66 kDa), and b-lactoglobulin(35 kDa). In the experiment testing the stability of native ... deletion strains and from a wild-type strain. In the DQCR9, DISP and DBCS1strains, a protein band of approximately 500 kDa wasimmunodecorated with a polyclonal antiserum directedagainst the bc1core...
- 15
- 639
- 0
Tài liệu Báo cáo khoa học: The isolation and characterization of cytochrome c nitrite reductase subunits (NrfA and NrfH) from Desulfovibrio desulfuricans ATCC 27774 Re-evaluation of the spectroscopic data and redox properties ppt
... remaining hemes and the dihedral angles of the axially coordinated Hissupport this assignment (Fig. 7, interplanar angles in legend). The Mo¨ssbauer data reveals the presence of two low-spin ... desulfuricansATCC 27774Re-evaluation of the spectroscopic data and redox propertiesMaria Gabriela Almeida1, So a Macieira2, Luisa L. Gonc¸alves1, Robert Huber2, Carlos A. Cunha1,Maria Joa˜o ... compriseCytc_DdesCytc_DgigNrfH_WsucNrfH_SdelNrfH_DdesCymA_SputNapC_RsphNapC_PpanNapC_AbraNapC_Paer VDAPADMV.IKAPAGAKVTKAPV AFSHKGHASM VDVPADGAKIDFIAGGE.KNLTV VFNHSTHKDV MNKSKFLVYSSLVVFAI ALGLFVYLVNASKALSYLSSDPKACI NCHVM. NPQYAT MKNSNFLKYAALGAFIVAIGFFVYMLNASKALSYLSSDPKACI...
- 12
- 593
- 0
Báo cáo khoa học: "Targeted Help for Spoken Dialogue Systems: intelligent feedback improves naive users'''' performance" pdf
... interaction, adaptation and styles of management, page (in press).Oliver Lemon, Anne Bracy, Alexander Gruenstein, and Stanley Peters. 2001. Information states in a multi-modal dialogue system for ... PlaceEdinburgh EH8 9LW, UKolemon@inf.ed.ac.ukEllen CampanaLaura HiattGregory AistDepartment of Brain Center for the Study of LanguageRIACS and Cognitive Sciences and Information ... nat-ural language system for spoken language under-standing. In Proceedings of the Thirty-First AnnualMeeting of the Association for Computational Lin-guistics.J. Dowding, G. Aist, B .A. ...
- 8
- 306
- 0
Từ khóa: Báo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Báo cáo quy trình mua hàng CT CP Công Nghệ NPVchuyên đề điện xoay chiều theo dạngNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Thơ nôm tứ tuyệt trào phúng hồ xuân hươngKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ