báo cáo khoa học: " Genetic mapping of wild introgressions into cultivated peanut: a way toward enlarging the genetic basis of a recent allotetraploid" docx
... mapping of wild introgressions into cultivated peanut: a way toward enlarging the genetic basis of a recent allotetraploid Daniel Foncéka 1 , Tossim Hodo-Abalo 2,3 , Ronan Rivallan 1 , Issa ... result indicates that A. duran- ensis and A. ipaiensis are more closely related to the A and the B genomes of the cultivated species than are A. carde-...
Ngày tải lên: 12/08/2014, 03:21
... Interestingly, GPR30 has been proposed to activate the PKA p athway in breast cancer cells [33]. Activation of the MAPK pathway has been shown to affect the transcriptional activation o f various receptors ... product of 216 bp. Additionally, forward primer 5¢-GAGCCCC AAGAAGAAAGA-3¢ and reverse primer 5¢- CATCCAAAATCTCC TCCA-3¢ were used. Primer pair 2 resulted in a PCR product o...
Ngày tải lên: 16/03/2014, 18:20
... the addition of propofol to achieve and maintain optimal sedation and analgesia. This was to allow assessment of the efficacy of remifentanil as initial treatment while administering a clinically relevant ... Spain 3 Consultant Anaesthetist, Department of Anaesthesia, Leeds General Infirmary, Leeds, UK 4 Attending Staff, Department of Anaesthesiology, Hospital Juan Canalejo, S...
Ngày tải lên: 12/08/2014, 20:20
Báo cáo khoa học: Epitope mapping of the O-chain polysaccharide of Legionella pneumophila serogroup 1 lipopolysaccharide by saturation-transfer-difference NMR spectroscopy pot
... remained unchanged at high pH, although at l ow pH (pH 2) it seemed that the ratio of the signals, balanced at neutral pH, was slightly changed towards the 3-E isomer. On the other hand, at constant pH 7.5 the ... fatal progression [1]. The reservoirs of legion ellae a re natural or man-made water systems and their natural hosts are various amoebae species [2]. In the hu...
Ngày tải lên: 08/03/2014, 10:20
Báo cáo khoa học: "Lymphatic mapping and sentinel node biopsy in gynecological cancers: a critical review of the literature" pot
... carcinomas, while the rest are melanoma, adenocarcinoma, basal cell carci- noma and sarcoma [7]. Nodal metastasis in vulva cancer is the main prognostic factor, irrespective of the size of the ... whereas Lev- enback found 9% of the sentinel nodes in the paraaortic area, 11% in the common iliac, 71% in the external iliac, and 9% in the parametrial area in a study inc...
Ngày tải lên: 09/08/2014, 07:21
báo cáo khoa học: " Functional mapping of reaction norms to multiple environmental signals through nonparametric covariance estimation" ppsx
... a nonparametric covariance estimator in func- tional mapping. It was nonparametric in the sense that the covar iance matrix has an unc onstrained set of para- meters to be estimated and not the ... temperature. As stated earlier, the main idea is to model irradiance as a one-dimensional spatial variable and temperature as a temporal variable. The choice of which environme...
Ngày tải lên: 11/08/2014, 11:21
báo cáo khoa học: " Association mapping of common bacterial blight resistance QTL in Ontario bean breeding populations" docx
... while association mappings rely on historical differential decay of LD between pairs of loci in natural and dome sticated popu- lations [12]. Therefore, association mapping has the advantage over ... demonstr ated that association mapping using a reasonable number of markers, distributed across the genome and with a pplication of plant materials that are routinely develope...
Ngày tải lên: 11/08/2014, 11:21
báo cáo khoa học: " Association mapping and marker-assisted selection of the lettuce dieback resistance gene Tvr1" potx
... CLSM9959.b1_N18.ab1 F - TGCTCAATTACACTCGAACCA 57 1.5 326 R - CTTCATGGAGAGAAATACAAGGTC CLSZ1525 CLSZ1525.b1_J22.ab1 F - TTGTTGAAATTATAAACACGAAGCA 57 3 499-629 R - CAACAAAGGATGTCTCAAATTCA QGC11N03 QGC11N03.yg.ab1 ... 326 R - CTTCATGGAGAGAAATACAAGGTC CLSZ1525 CLSZ1525.b1_J22.ab1 F - GAAGAAACTCATGAATCTGCTCAA 62 3 157-158 R - TTTGCTCAAGAACTCTTAAACCATT Cntg11275 CLS_S3_Contig11275 F - CCAAACCATAGGG...
Ngày tải lên: 12/08/2014, 03:21
báo cáo khoa học: " QTL mapping of agronomic traits in tef [Eragrostis tef (Zucc) Trotter]" pdf
... developed the RILs and coordinated the field studies. MES conceived of the study, and participated in the design of the study, data analyses and manuscript preparation. All authors read and approved the ... 1). Early matu- rity is a common characteristic of wild relatives of tef and E. pilosa (30-5) matured on average 12 days earlier than Kaye Murri. On the other han...
Ngày tải lên: 12/08/2014, 05:20
Báo cáo khoa học: 15 N-Labelled proteins by cell-free protein synthesis Strategies for high-throughput NMR studies of proteins and protein–ligand complexes doc
... [ 15 N]-labelled amino acids. The most abundant amino acids are labelled in only one of the samples, while the least abundant amino acids are labelled in up to three of the samples. The pattern of occurrence ... resonance assignments of the [ 15 N]-HSQC peaks are obtained in this way so long as the corresponding amino acid pairs are unique in the amino acid sequence....
Ngày tải lên: 07/03/2014, 12:20