... TAACCCTGCTACTAATCCAAGTGCAGAAGAACAAATCAAAATCAACCTTACTTGGATGCATAAACAAATGATCTCCAACAGCAAGACCAATAGACAATTT PPO1/5 (701) TAACCCTGCTACTAATCCAAGTGCAGAAGAACAAATCAAAATCAACCTTACTTGGATGCATAAACAAATGATCTCCAACAGCAAGACCCCTAGACAATTT 801 ... CCATTTTTACAAATCCAAATTCTTCCCTTTATGACCCTAGAAGAAATCCCTCACATCAACCACCAACAATCGTTGACCTAAACTATAACAAAGCTAATGA 701 800 PPO1/2 (701) TAACCCTGCTACTAATCCAAGTGCAGAAGAACAAATCAAAATCAAC...
Ngày tải lên: 12/08/2014, 03:20
... UAB-Pirogov-NDRI-Substance Abuse ICOHRTA In Ukraine (International Clinical, Operational and Health Services Research Training Award). The funder did not play a role in design, data collection, analysis and interpretation; ... participated in statistical analyses and interpretation of results and helped to draft the manu- script. OZ participated in data collection, statistical...
Ngày tải lên: 11/08/2014, 18:20
Báo cáo khoa học: "Parsing with an Extended Domain of Locality" pot
... Pennsylvania, Philadel- phia, PA. Marie-H ~l~ ne Candito. 1996. A principle- based hierarchical representation of LTAGs. In Proceedings of the 16th International Con- ference on Computational Linguistics, ... tree, and the sub- tree headed by the anchor usually plays a role of adjunct in the resulting tree. Coordination auxil- iary trees are similar to modifier auxiliary...
Ngày tải lên: 08/03/2014, 21:20
Báo cáo khoa học: "Redundancy Ratio: An Invariant Property of the Consonant Inventories of the World’s Languages" pdf
... sounds of a language with minimum ef- fort. In fact, the organization of the vowel inven- tories (especially those with a smaller size) across languages has been satisfactorily explained in terms of ... characterization of the consonants. Ide- ally, if redundancy has to be invariant, then this ca- pability should be almost constant. As a proof of concept we randomly select...
Ngày tải lên: 17/03/2014, 04:20
Báo cáo khoa học: LIN54 is an essential core subunit of the DREAM / LINC complex that binds to the cdc2 promoter in a sequence-specific manner ppt
... D ATTTGAACTGTGCCAGGACTGGGAGAAAAAATTTAAGATCT ATTTGAACTGTGCCAATGAGAGGAGAAAAAATTTAAGATCT ATTTGAACTGTGCCAATGCTGAAGGAAAAAATTTAAGATCT ATTTGAACTGTGCCAATGCTGGGAAGGAAAATTTAAGATCT ATTTGAACTGTGCCAATGCTGGGAGAAGGGATTTAAGATCT ATTTGAACTGTGCCAATGCTGGGAGAAAAAGGGTAAGATCT ATTTGAACTGTGCCAATGCTGGGAGAAAAAATTGGGGATCT Mut ... GHIF ATTTGAACTGTGCCAATGCTGGGAGAAAAAATTTAAGATCT CHRup MYB1 ATTTGAACTAGACCAATGCTGGGAGAAAAAATT...
Ngày tải lên: 23/03/2014, 04:20
Báo cáo khoa học: Cupiennin 1a, an antimicrobial peptide from the venom of the neotropical wandering spider Cupiennius salei, also inhibits the formation of nitric oxide by neuronal nitric oxide synthase pptx
... N-terminal catalytic oxygenase domain that binds heme, tetrahydrobiopter- in and l- arginine; (b) a C-terminal reductase domain that binds FMN, FAD and NADPH; and (c) an inter- vening CaM-binding ... body length and have a 100 mm leg span, whereas males are typically smaller and less brightly coloured [1]. The venom of C. salei is a natural insecticide, caus- ing a rapid and do...
Ngày tải lên: 23/03/2014, 09:21
Báo cáo khoa học: "Identification of Acanthocephala discovered in changran-pickles and myungran-pickles" docx
... the length, and width of the body and internal organs were measured. Species identification was made according to Van Cleave [9] and Yamaguti [11] classification of the acanthocephala. Results Morphology ... respectively made from Gadus macrocophulus and Theragra chalcogramma caught in the Korea, by morphological observation and the measurement of internal organs. Materials and Meth...
Ngày tải lên: 07/08/2014, 15:20
Báo cáo khoa học: "Identification and epidemiological characterization of Streptococcus uberis isolated from bovine mastitis using conventional and molecular methods" pdf
... from January to March 1999 at different locations in Hesse, Germany. Approximately 0.1 ml milk obtained from clinical as well as subclinical milk samples were initially plated on sheep blood agar (Oxoid, ... Citrate azide tween carbonate agar (CATC, Merck), Kanamycin esculin azide agar (KAA, Merck), Esculin bile agar (Oxoid), Chromocult enterococci agar (Merck), and Slanetz-Bartley media (O...
Ngày tải lên: 07/08/2014, 17:22
Báo cáo khoa học: " Identification of a putative cellular receptor 150 kDa polypeptide for porcine epidemic diarrhea virus in porcine enterocytes" pps
... 3-ST cells, La ne 4 -Vero cells, Lane 5-negative control. (b) PEDV using monoclonal antibody. Lane 1,2-porcine enterocytes, Lane 3-Vero cells, Lane 4- S T cells, Lane 5, 6-negative control. (c) ... identify cellular proteins involved in PEDV binding, VOPBA was carried out. In brief, membrane proteins of cells were separated by SDS- PAGE. Cellular membranes of porcine brush border,...
Ngày tải lên: 07/08/2014, 17:22
Báo cáo khoa học: " Identification and antigenic site analysis of foot-and-mouth disease virus from pigs and cattle in Korea" doc
... clinical samples of the 2002 FMD outbreaks in Korea and then analyzed full sequences of VP1 gene and antigenic sites of O/SKR/2002. Materials and Methods Diagnosis of FMD National Veterinary and ... strains from the Gene Bank databank (NCBI) were aligned and analyzed (Fig. 4). Almost East Asian strains belong to the Middle East-South Asian (ME-SA) topotype, but two Taiwanese str...
Ngày tải lên: 07/08/2014, 18:21