báo cáo khoa học: " Agrobacterium rhizogenes-mediated transformation of Superroot-derived Lotus corniculatus plants: a valuable tool for functional genomics" pptx
báo cáo khoa học: " Agrobacterium rhizogenes-mediated transformation of Superroot-derived Lotus corniculatus plants: a valuable tool for functional genomics" pptx
... 5'-GATGATAGTTACA- GAACCGACG-3' (forward), 5'-CATTCGGAATCTC- CACGTTAC-3' (reverse).GFP: 5'-GTAAACGGCCACAAG TTCAGCG-3' (forward), 5'-TCGTCCATGCCGAGAGTGA TCC-3' ... amplification: 5'-ACACTATTTGGTGCCGTTGG-3' (forward) and 5'- CTTCCAACCAGAACCAACCC-3' (reverse) for TaNHX2; 5'-TCTGATACTGTTGTGGAGCCT-3' (forward) and 5' TGGGA...
Ngày tải lên: 12/08/2014, 03:20
Tài liệu Báo cáo khoa học: Receptor binding characteristics of the endocrine disruptor bisphenol A for the human nuclear estrogen-related receptor c pptx
... keep their conformation in a fully activated form. The Arg316 fi Ala and Glu275 fi Ala substi- tutions appear to damage intrinsically the activation conformation to a level that BPA is unable to rescue completely. It ... bonds of the bisphenol A phenol-hydroxyl group with Arg316 and Glu275 residues Xiaohui Liu, Ayami Matsushima, Hiroyuki Okada, Takatoshi Tokunaga, Kaname Isozaki and Yas...
Ngày tải lên: 18/02/2014, 16:20
Báo cáo khoa học: Alternative splicing: regulation of HIV-1 multiplication as a target for therapeutic action docx
... hnRNP A1 C UAGACUAGA 5428–5437 ESE2 SC35, SRp40 CCAGUAGAUCCUAGACUAGA 5418–5437 A5 ESE GAR ASF ⁄ SF2, SRp40 GAAGAAGCGGAGACAGCGACGAAGA 5558–5582 [7] A7 ESS3 hnRNP A1 , hnRNP E1 ⁄ E2 AGAUCCAUUCGAUUAG unknown 8047–8062 ... 32] ISS hnRNP A1 UAGUGAAUAGAGUUAGGCAGGGA 7928–7950 ESE3 ASF ⁄ SF2 GAAGAAGAA 8016–8025 hnRNP A1 UAGAAGAAGAA 8018–8025 HIV-1 alternative splicing regulation J. Tazi et al....
Ngày tải lên: 06/03/2014, 09:22
Báo cáo khoa học: Unconventional translation initiation of human trypsinogen 4 at a CUG codon with an N-terminal leucine A possible means to regulate gene expression pdf
... immunoserologically the mAbs raised against the protease domain (mAb 1 ⁄ B1 and mAb 6 ⁄ B7) and the 28-amino acid leader peptide (mAb p28) of human trypsinogen 4 (data not shown). Immunoaffinity media preparation mAbs ... transmembrane protein does not necessar- ily mean that translation starts from a downstream AUG, as predicted by genome and mRNA analysis, but raises the possibility that...
Ngày tải lên: 07/03/2014, 10:20
Báo cáo khoa học: Specific degradation of H. pylori urease by a catalytic antibody light chain pptx
... Corporation), Saitama, Japan 3 Oita University, Faculty of Medicine, Oita, Japan Many natural catalytic antibodies have been discov- ered in the last decade. The first natural catalytic anti- body ... documented that the light chain of an antibody could possess a catalytic cleavage activity against peptides and ⁄ or proteins [4–6,18,22]. HpU-9-L displayed catalytic ability. In our cleava...
Ngày tải lên: 07/03/2014, 21:20
Báo cáo khoa học: "The Benefit of Stochastic PP Attachment to a Rule-Based Parser" doc
... the subtask of syntax analysis, the di- chotomy manifests itself in the existence of learnt and handwritten grammars of natural languages. A great many formalisms have been advanced that fall into ... for rule-based syntax analysis and has often been at- tacked by statistical methods. Because probabilistic approaches solve PP at- tachment as a natural subtask of parsing anyhow,...
Ngày tải lên: 17/03/2014, 04:20
Báo cáo khoa học: Expression and characterization of recombinant 2¢,5¢-oligoadenylate synthetase from the marine sponge Geodia cydonium ppt
... 7, p 3 A3 ¢p5 A2 ¢p5 A; 8, p 3 A3 ¢p5 A3 ¢p5 A; 9, adenosine; 10, mixture of A2 ¢p5 A and A2 ¢p5 A2 ¢p5 A2 ¢p5 A; 11, mixture of A2 ¢p5 A2 ¢p5 A and A3 ¢p5 A2 ¢- p5 A( m ⁄ z 924.6); 12, A2 ¢p5 A3 ¢p5 A( m ⁄ z ... transferases of other famil- ies; however, the catalytic domain features of 2- 5A synthetases and other polymerases (e.g. DNA poly- merase b) are conserved [19,21]...
Ngày tải lên: 23/03/2014, 09:20
Báo cáo khoa học: The crystal structure of Thermoactinomyces vulgaris R-47 a-amylase II (TVA II) complexed with transglycosylated product potx
... starch and pullulan. The K m value of Y37 4A for starch was almost identical to that of the wild-type enzyme and that of Y37 4A for pullulan showed nearly a threefold decrease compared to that of ... Yanase, M., Takata, H., Shimada, J., Handa, S., Takada, T., Umeyama, H. & Okada, S. (1996) Con- trolling substrate preference and transglycosylation activity of neopullulana...
Ngày tải lên: 23/03/2014, 12:20
Báo cáo khoa học: The transmembrane domain of subunitbof theEscherichia coli F1FOATP synthase is sufficient for H + -translocating activity together with subunitsaandc doc
... stoichiometric amounts were calcu lated based on t he amino a cid analysis performed during the synthesis of b 1)34 and c alibrated w ith the F O sample assuming a stoichiometry of ab 2 c 10 . Dialysis wascarriedoutfor40hat4°C ... F O [6]. This physical linkage between the site o f catalysis and ion translocation is further associated with functional needs of coupling by means of...
Ngày tải lên: 23/03/2014, 13:20
Báo cáo khoa học: Cytoskeleton-modulating effectors of enteropathogenic and enterohemorrhagicEscherichia coli: a case for EspB as an intrinsically less-ordered effector pptx
... 2403–2408. 9 Hamaguchi M, Hamada D, Suzuki KN, Sakata I & Yanagihara I (2008) Molecular basis of actin reorgani- zation promoted by binding of enterohaemorrhagic Escherichia coli EspB to a- catenin. ... Y, Sagara H, Kabe Y, Azuma M, Kume K, Ogawa M, Nagai T, Gillespie PG, Sasakawa C & Handa H (2007) The enteropathogenic E. coli effector EspB facillitates microvillus effacing and...
Ngày tải lên: 29/03/2014, 09:20