0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

báo cáo khoa học: " Detection and validation of single feature polymorphisms using RNA expression data from a rice genome array" pot

báo cáo khoa học:

báo cáo khoa học: " Detection and validation of single feature polymorphisms using RNA expression data from a rice genome array" pot

... TCAACTCGGAAGAACTCTTCTAACACTTAATCGTTTGTCAATCCCTGAGCCACTGAGGTACTAGG AAGGAAACAAATGAAAAT TCAACTCGGAAGAACTCTTCTAACACTTAATCGTTTGTCAATCCCTGAGCCACTGAGGTACTAGG AAGGAAACAAATGAAAAT TCAACTCGGAAGAACTCTTCTAACACTTAATCGTTTGTCAATCCCTGAGCCACTGAGGTACTAGG ... TCAACTCGGAAGAACTCTTCTAACACTTAATCGTTTGTCAATCCCTGAGCCACTGAGGTACTAGG AAGGAAACAAATGAAAAT TCAACTCGGAAGAACTCTTCTAACACTTAATCGTTTGTCAATCCCTGAGCCACTGAGGTACTAGG AAGGAAACAAATGA012IFPS: 83: 83: 83: 832_atCATACTGGTAAAGCTTTTATTGTTTTCTATCATTATAATAGCTCTTTTTCTTTTTTGCTTATT ... TCAGCT G T CATTAT A C TTATCT G G GAAAA T G C AATGA A G T TATTTTC T G ATTTCT C C TGATGAAG T T GAGTT G T C TTGAAGT G GGTCACT A T GAAAAC T A TCAGCT G T CATTAT A C TTAACT G G GAAAA T G C AATGA A...
  • 10
  • 250
  • 0
Báo cáo khoa học: Detection and characterization of a novel extracellular fungal enzyme that catalyzes the specific and hydrolytic cleavage of lignin guaiacylglycerol b-aryl ether linkages pdf

Báo cáo khoa học: Detection and characterization of a novel extracellular fungal enzyme that catalyzes the specific and hydrolytic cleavage of lignin guaiacylglycerol b-aryl ether linkages pdf

... Seiichiro Ikeda1, Shinya Kajita1, Masaya Nakamura2 and Yoshihiro Katayama11Graduate School of Bio-Applications and Systems Engineering, Tokyo University of Agriculture and Technology, Koganei, ... °C, b-aryl ether cleavage activity wasmeasured as described above.Localization of b-aryl ether cleavage activity A 14-day-old culture (4 mL) of 2BW-1 cells was separatedinto supernatant and ... of 18Ofromradio-labeled water was not observed with guaiacol.It was clear that the b-aryl ether cleavage enzymecatalyzed the addition of two molecules of H2O(atCa and Cb positions) and cleavage the b-aryl...
  • 10
  • 670
  • 0
báo cáo khoa học:

báo cáo khoa học:" Development and validation of a questionnaire on ‘Satisfaction with dermatological treatment of hand eczema’ (DermaSat)" potx

... 2010,17(3):131-143.doi:10.1186/1477-7525-8-127Cite this article as: Ruiz et al.: Development and validation of a questionnaire on ‘Satisfaction with dermatological treatment of handeczema’ (DermaSat). Health and Quality of Life Outcomes ... exploratory factor analysis, and reliability was evaluated on the basis of internal consistency and twohalves reliability estimates. Item discriminant capability and questionnaire discriminan t validity ... 8:127http://www.hqlo.com/content/8/1/127Page 4 of 16RESEARC H Open AccessDevelopment and validation of a questionnaireon ‘Satisfaction with dermatological treatment of hand eczema’ (DermaSat)Miguel A Ruiz1*, Felipe Heras2, Agusti...
  • 16
  • 439
  • 0
báo cáo khoa học:

báo cáo khoa học:" Development and validation of a short version of the Assessment of Chronic Illness Care (ACIC) in Dutch Disease Management Programs" doc

... for data gathering. JC, AN and AT were involved inacquisition of subjects and data. JC, AN and MS performed statistical analysis and interpretation of data. JC drafted the manuscript. AN, MS and ... systems.Organisational interventionsMany forms of organisational changes are applied in the22 DMPs. Examples of organisational interventions arenew collaborations of care providers, allocating tasks ... univariate and bivariate nor-mality, and to detect outliers. No extreme values werefound. Some items had a relatively high number of missing data and ‘not applicable’ answers, in particularthose...
  • 10
  • 392
  • 0
Báo cáo khoa học:

Báo cáo khoa học: " Detection and quantification of pestivirus in experimentally infected pregnant ewes and their progeny" pps

... Department of Animal Health, Berreaga 1, 48160 Derio, Bizkaia, Spain and 2Vacunek SL, Ibaizabal Bidea 800, 48160 Derio, Bizkaia, SpainEmail: Ana Hurtado* - ahurtado@neiker.net; Isbene Sanchez ... genewhich acted as an indicator of RNA integrity, since sam-ples available for routine laboratory analysis of abortionsare in many cases affected by different degrees of autolysisthat can compromise ... 86:345-352.8. Garcia-Perez AL, Minguijon E, Barandika J, Aduriz G, Povedano I, JusteRA, Hurtado A: Detection of Border disease virus in fetuses,stillbirths, and newborn lambs from natural and experimen-tal...
  • 8
  • 290
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Development and Validation of a HPV-32 Specific PCR Assay" ppsx

... Developed and ran the HPV-32 specific PCR assay,did all statistical analysis, and prepared the manu-script.NH: Extracted the clinical samples and tested themvia the PGMY and HPV-32 dot blot assay. ... blot assay. The HPV-32 type specific PCRassay has a sensitivity of 95.8% and a specificity of 87.8%with a kappa of 0.32 ± 0.029 as compared to the HPV-32dot blot assay. When analyzed according ... for example) are associatedwith human malignancy including as much as 95% of cer-vical cancers and up to 35% of oral malignancies. The lowrisk HPV types, for example HPV-6 and -11, are the...
  • 7
  • 352
  • 0
Tài liệu Báo cáo khoa học: Isolation and characterization of four type 2 ribosome inactivating pulchellin isoforms from Abrus pulchellus seeds docx

Tài liệu Báo cáo khoa học: Isolation and characterization of four type 2 ribosome inactivating pulchellin isoforms from Abrus pulchellus seeds docx

... withinthe last 30 years. The greatest number of RIPs havebeen found in the Caryophyllaceae, Sambucaceae,Cucurbitaceae, Euphorbiaceae, Phytolaccaceae and Poaceae [1]. Although many are potentially ... sugars of three classes. Whereasagglutination was inhibited by galactose and its deriva-tives [such as N-acetylgalactosamine (GalNAc),methyl -a- d-galactopyranoside], it was evident that, atdoses ... hemagglutination and toxicitytoward mice (data not shown), additional efforts tocleanly isolate the isoform were not successful and further characterization was abandoned. A chromato-focusing...
  • 12
  • 763
  • 0
Báo cáo khoa học:

Báo cáo khoa học: " Identification and prevalence of Ehrlichia chaffeensis infection in Haemaphysalis longicornis ticks from Korea by PCR, sequencing and phylogenetic analysis based on 16S rRNA gene" docx

... chaffeensisstrains available in the GenBank database showed that EC-PGHL was 100% identical or similar to the Arkansas(AF416764), the Sapulpa (U60476) and the 91HE17(U23503) strains, all of these ... accessionnumber AY35042) with the sequences of 20 E. chaffeensisstrains available in the database showed that EC-PGHLwas 100% identical or similar to the Arkansas (AF416764),the Sapulpa (U60476) and the ... on the combined evaluation of clinicalsigns, laboratory and epidemiological data. Since mostphysicians are unfamiliar with HME, this disease is oftenmisdiagnosed and many cases develop into...
  • 5
  • 353
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Isolation and identification of Escherichia coli O157:H7 using different detection methods and molecular determination by multiplex PCR and RAPD" docx

... CCTGTCAACTGAGCAGCACTTTGeae A- F GTGGCGAATACTGGCGAGACT 890 bp Fagan et al [14]eae A- R CCCCATTCTTTTTCACCGTCGhly A- F ACGATGTGGTTTATTCTGGA 165 bp Fagan et al [14]hly A- R CTTCACGTGACCATACATATH7-F ... RD, Barna A, Lipman LJA, Bijker PGH.Comparison of the sensitivity of manual and automatedimmunomagnetic separation methods for detection of Shiga10 Ji-Yeon Kim et al.(Nasco, USA), and placed ... C, da Silveira WD, da Silva Correa S, Nakazato G,Bando SY, Ribeiro MA, Pestana de Castro AF.Microbiological comparative study of isolates of Edwardsiella tarda in different countries from...
  • 13
  • 456
  • 0

Xem thêm

Từ khóa: báo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpBáo cáo quy trình mua hàng CT CP Công Nghệ NPVchuyên đề điện xoay chiều theo dạngNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát hiện xâm nhập dựa trên thuật toán k meansTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)BÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIĐổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namMÔN TRUYỀN THÔNG MARKETING TÍCH HỢPQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ