báo cáo khoa học: " Detection and validation of single feature polymorphisms using RNA expression data from a rice genome array" pot

... TCAACTCGGAAGAACTCTTCTAACACTTAATCGTTTGTCAATCCCTGAGCCACTGAGGTACTAGG AAGGAAACAAATGA AAAT TCAACTCGGAAGAACTCTTCTAACACTTAATCGTTTGTCAATCCCTGAGCCACTGAGGTACTAGG AAGGAAACAAATGA AAAT TCAACTCGGAAGAACTCTTCTAACACTTAATCGTTTGTCAATCCCTGAGCCACTGAGGTACTAGG ... TCAACTCGGAAGAACTCTTCTAACACTTAATCGTTTGTCAATCCCTGAGCCACTGAGGTACTAGG AAGGAAACAAATGA AAAT TCAACTCGGAAGAACTCTTCTAACACTTAATCGTTTGTCAATCCCTGAGCCACTGAGGTACTAGG A...

Ngày tải lên: 12/08/2014, 03:20

... Seiichiro Ikeda 1 , Shinya Kajita 1 , Masaya Nakamura 2 and Yoshihiro Katayama 1 1 Graduate School of Bio-Applications and Systems Engineering, Tokyo University of Agriculture and Technology, Koganei, ... °C, b-aryl ether cleavage activity was measured as described above. Localization of b-aryl ether cleavage activity A 14-day-old culture (4 mL) of 2BW-1 cells was separated in...

Ngày tải lên: 17/03/2014, 03:20

... 2010, 17(3):131-143. doi:10.1186/1477-7525-8-127 Cite this article as: Ruiz et al.: Development and validation of a questionnaire on ‘Satisfaction with dermatological treatment of hand eczema’ (DermaSat). Health and Quality of Life Outcomes ... exploratory factor analysis, and reliability was evaluated on the basis of internal consistency and two halves reliability estimat...

Ngày tải lên: 12/08/2014, 01:21

... for data gathering. JC, AN and AT were involved in acquisition of subjects and data. JC, AN and MS performed statistical analysis and interpretation of data. JC drafted the manuscript. AN, MS and ... systems. Organisational interventions Many forms of organisational changes are applied in the 22 DMPs. Examples of organisational interventions are new collaborations of c...

Ngày tải lên: 12/08/2014, 01:22

... Department of Animal Health, Berreaga 1, 48160 Derio, Bizkaia, Spain and 2 Vacunek SL, Ibaizabal Bidea 800, 48160 Derio, Bizkaia, Spain Email: Ana Hurtado* - ahurtado@neiker.net; Isbene Sanchez ... gene which acted as an indicator of RNA integrity, since sam- ples available for routine laboratory analysis of abortions are in many cases affected by different degrees of autolysis t...

Ngày tải lên: 12/08/2014, 04:20

... Developed and ran the HPV-32 specific PCR assay, did all statistical analysis, and prepared the manu- script.NH: Extracted the clinical samples and tested them via the PGMY and HPV-32 dot blot assay. ... blot assay. The HPV-32 type specific PCR assay has a sensitivity of 95.8% and a specificity of 87.8% with a kappa of 0.32 ± 0.029 as compared to the HPV-32 dot blot assa...

Ngày tải lên: 12/08/2014, 04:22

... within the last 30 years. The greatest number of RIPs have been found in the Caryophyllaceae, Sambucaceae, Cucurbitaceae, Euphorbiaceae, Phytolaccaceae and Poaceae [1]. Although many are potentially ... sugars of three classes. Whereas agglutination was inhibited by galactose and its deriva- tives [such as N-acetylgalactosamine (GalNAc), methyl -a- d-galactopyranoside], it was evident...

Ngày tải lên: 18/02/2014, 16:20

... chaffeensis strains available in the GenBank database showed that EC- PGHL was 100% identical or similar to the Arkansas (AF416764), the Sapulpa (U60476) and the 91HE17 (U23503) strains, all of these ... accession number AY35042) with the sequences of 20 E. chaffeensis strains available in the database showed that EC-PGHL was 100% identical or similar to the Arkansas (AF416764), the Sap...

Ngày tải lên: 07/08/2014, 18:21

... CCTGTCAACTGAGCAGCACTTTG eae A- F GTGGCGAATACTGGCGAGACT 890 bp Fagan et al [14] eae A- R CCCCATTCTTTTTCACCGTCG hly A- F ACGATGTGGTTTATTCTGGA 165 bp Fagan et al [14] hly A- R CTTCACGTGACCATACATAT H7-F ... RD, Barna A, Lipman LJA, Bijker PGH. Comparison of the sensitivity of manual and automated immunomagnetic separation methods for detection of Shiga 10 Ji-Yeon Kim et al. (N...

Ngày tải lên: 07/08/2014, 18:21

...

Ngày tải lên: 07/08/2014, 18:21