báo cáo khoa học: " Construction of a consensus linkage map for red clover (Trifolium pratense L )" docx

báo cáo khoa học: " Construction of a consensus linkage map for red clover (Trifolium pratense L.)" docx

báo cáo khoa học: " Construction of a consensus linkage map for red clover (Trifolium pratense L.)" docx

... Hay- ashi M, Pedrosa A, Onda R, Imaizumi-Anraku H, Bachmair A, Sandal N, Stougaard J, Murooka Y, Tabata S, Kawasaki S, Kawaguchi M, Harada K: Construction of a genetic linkage map of the model legume ... mapping module of the individual maps were same as the consensus map. Genome-wide allele frequency Plant material and marker analysis A total of 1144 individuals were...
Ngày tải lên : 12/08/2014, 03:20
  • 11
  • 251
  • 0
Báo cáo khoa học: Construction of a novel detection system for protein–protein interactions using yeast G-protein signaling pdf

Báo cáo khoa học: Construction of a novel detection system for protein–protein interactions using yeast G-protein signaling pdf

... GCCCGGATCCTGATAGTAATAGAATCCAAA 4 CCCCGAATTCAAATTATAGAAAGCAGTAGA 5 AAGGCTCGAGAGATCTGTTTAGCTTGCCTC 6 AAAAGTCGACGAGCTCGTTTTCGACACTGG 7 TTTTGTCGACATGGCGCAACACGATGAAGC CGTAGACAAC 8 GGGGGGATCCTTACATAAGCGTACAACAAA CACTATTTGATTTCGGCGCCTGAGCATCA TTTAGCTTTTT 9 ... AAACGCCTTCGCCCAAAGTTTAAAAGATGA 22 TCATCTTTTAAACTTTGGGCGAAGGCGTTT 23 TTTTCTCGAGAAAGATGCCGATTTGGGCGC 24 GGGGCTCGAGGTTTTATATTTGTTGTAAAA 25 ATAT...
Ngày tải lên : 16/03/2014, 01:20
  • 9
  • 444
  • 0
báo cáo khoa học: " Construction of a potato consensus map and QTL meta-analysis offer new insights into the genetic architecture of late blight resistance and plant maturity traits" pps

báo cáo khoa học: " Construction of a potato consensus map and QTL meta-analysis offer new insights into the genetic architecture of late blight resistance and plant maturity traits" pps

... convenience, meta- QTLs of late blight resistance were called “late blight meta-QTLs”,andmeta-QTLsofmaturity,vigourand plant height were called “maturity meta-QTLs”. Additional material Additional file 1: ... determined. Table 1 Number of publications, maps and QTLs collected to perform meta-analysis No. of publications No. of maps No. of QTLs Available published data 19 (7) † 29 (8...
Ngày tải lên : 11/08/2014, 11:21
  • 17
  • 593
  • 0
Tài liệu Báo cáo khoa học: Application of a fluorescent cobalamin analogue for analysis of the binding kinetics A study employing recombinant human transcobalamin and intrinsic factor pdf

Tài liệu Báo cáo khoa học: Application of a fluorescent cobalamin analogue for analysis of the binding kinetics A study employing recombinant human transcobalamin and intrinsic factor pdf

... Authors Journal compilation ª 2006 FEBS Application of a fluorescent cobalamin analogue for analysis of the binding kinetics A study employing recombinant human transcobalamin and intrinsic factor Sergey ... radio- active ligand 57 Co-labeled Cbl for the binding to IF (or TC). It appeared that both the analogue and Cbl efficiently displaced 57 Co-labeled Cbl according to the ratio...
Ngày tải lên : 19/02/2014, 05:20
  • 12
  • 603
  • 0
Báo cáo khoa học: Characterization of a novel long-chain acyl-CoA thioesterase from Alcaligenes faecalis docx

Báo cáo khoa học: Characterization of a novel long-chain acyl-CoA thioesterase from Alcaligenes faecalis docx

... the abnormal accumulation of intracellular acyl-CoA. We have isolated a thioesterase from Alcaligenes faecalis ISH108 and demonstrated its application in chemoselective and racemization free deacylation ... immunogold labe- ling studies with ultrathin sections of Alcaligenes cells to localize thioesterase at the ultrastructural level. Polyclonal antibodies, AbTE-N and AbTE-D, raised aga...
Ngày tải lên : 16/03/2014, 13:20
  • 14
  • 513
  • 0
Báo cáo khoa học: Characterization of a second proliferating cell nuclear antigen (PCNA2) from Drosophila melanogaster docx

Báo cáo khoa học: Characterization of a second proliferating cell nuclear antigen (PCNA2) from Drosophila melanogaster docx

... thermo- stable DNA polymerase (TaKaRa, Ohtsu, Japan) and the following primers: forward, 5¢-ATGCTCGAGGCGCGTT Fig. 5. Association of Drosophila melanogaster proliferating cell nuclear antigen 2 (DmPCNA2) ... event. Association of DmPCNA2 with Drosophila DNA polymerases d and e PCNA was originally identified as a DNA sliding clamp for DNA polymerases [22]. In humans, PCNA associates with...
Ngày tải lên : 23/03/2014, 10:20
  • 12
  • 404
  • 0
Báo cáo khoa học: " Development of a neuro-fuzzy technique for automated parameter optimization of inverse treatment planning" doc

Báo cáo khoa học: " Development of a neuro-fuzzy technique for automated parameter optimization of inverse treatment planning" doc

... is identical to what the human planner does. Although interacting with the TPS at the level of deliverable plans Prostate plan evaluation for (a) ANFIS and (b) human planFigure 6 Prostate plan evaluation ... radiotherapy planning. They proposed two methods to analyse the database systemati- cally (principal component analysis and isomap method) Brain plan evaluation for (a) ANFIS and (b...
Ngày tải lên : 09/08/2014, 10:20
  • 16
  • 510
  • 0
báo cáo khoa học: " Development of a synoptic MRI report for primary rectal cancer" doc

báo cáo khoa học: " Development of a synoptic MRI report for primary rectal cancer" doc

... particular radiologists, will be critical for the suc- cessful implementation of the synoptic MRI report for rectal cancer. It will also allow for exploration of other potential organizational or ... gspiegle@uhnresearch.ca; Marisa Leon-Carlyle - marisa.leoncarlyle@uhnresearch.ca; Selina Schmocker - sschmocker@mtsinai.on.ca; Mark Fruitman - mark.fruitman@gmail.com; Laurent Milot -...
Ngày tải lên : 11/08/2014, 16:20
  • 6
  • 351
  • 0
Tài liệu Báo cáo khoa học: Modulation of a-synuclein aggregation by dopamine in the presence of MPTP and its metabolite pptx

Tài liệu Báo cáo khoa học: Modulation of a-synuclein aggregation by dopamine in the presence of MPTP and its metabolite pptx

... substantia nigra is a neuropathological hallmark of Parkinson’s disease. This leads to a decreased level of dopamine in the striatum. As a result, synaptic transmission is nega- tively affected ... solubilization, the chaotrope may not have been able to solubilize the amyloid aggre- gate of a- synuclein completely. It is probable that in the case of MPTP-modulated a- synuclein...
Ngày tải lên : 14/02/2014, 19:20
  • 11
  • 754
  • 0
Tài liệu Báo cáo khoa học: Comparison of a coq7 deletion mutant with other respiration-defective mutants in fission yeast doc

Tài liệu Báo cáo khoa học: Comparison of a coq7 deletion mutant with other respiration-defective mutants in fission yeast doc

... GAACCAATGAAATAAGGGCG cyc1-x GGGGATCCGTCGACCTGCAGCGTACGAGGAAAGGAAATAGGC cyc1-y GTTTAAACGAGCTCGAATTCATCGATCCGTCAACGACAGTTG cyc1-z GCATCAGAAAGCATAGGC cyc1-m TGGGAATACGATAGAGTAG nb2 primer GTTTAAACGAGCTCGAATTC Coq7 ... CGTATAAATTACAATACCG Spcoq3-x GGGGATCCGTCGACCTGCAGCGTACGACATACTACTTCATTTG Spcoq3-y GTTTAAACGAGCTCGAATTCATCGATCCTAGCGTTACCGTTG Spcoq3-z GTATGCGATGTGGAATTTG Spcoq3-m GATGCCTTCCAATGAAT...
Ngày tải lên : 18/02/2014, 14:20
  • 16
  • 646
  • 0