Báo cáo y học: "Identification and characterization of duck plague virus glycoprotein C gene and gene product" docx
Báo cáo y học: "Identification and characterization of duck plague virus glycoprotein C gene and gene product" docx
... construction Apairofprimers(5’ -CGGAATTCCAAAACGCCGCA- CAGATGAC-3’ and 5’ -CCCTCGAGGTATTCAAA- TAATATTGTCTGC-3’ ) was designed and used to amplify DPV gC gene from the genomic DNA. The amplified PCR ... 154:163-165. 15. Cheng AC, Wang MS, Wen M, Zhou WG, Guo YF, Jia RY, Xu C, Yuan GP, Liu YC: Construction of duck enteritis virus gene libraries and discovery, cloning and ident...
Ngày tải lên: 12/08/2014, 02:20
Báo cáo y học: "Reverse genetic characterization of the natural genomic deletion in SARS-Coronavirus strain Frankfurt-1 open reading frame 7b reveals an attenuating function of the 7b protein in-vitro and in-vivo" pptx
... 5'-TAGACTACGCCGGCG - TAGCCTTAGGTTTAAAAACAATTGCCACTC-3' and 5'- TACACTCAACACGTGTGGCACGATTGCGCT-3' (5'-part); and primers 5'-AGCGCAATCGTGCCACACGTGTTGAGT- GTA-3&apos ;and 5'-TGAACCGCCACGCTGGCTAAACC-3' ... 5'- TACTAATACGACTCACTATAGATATTAGGTTTTTACC TA CCCAGG-3' and A1rev 5'-aatgccagtatgacctgagccaatatc-3' and A2fwd 5'-GATATTG...
Ngày tải lên: 12/08/2014, 04:20
Báo cáo y học: "The minimal kinome of Giardia lamblia illuminates early kinase evolution and unique parasite biology" docx
... 5’-gatatcctgtctgagcatctcgcacagc-3’, and Orf_15409 with primers 5’-tttaagcttcccctgccgctgagtgaaca t-3’ and 5’- tttgggccccaggttcaggacctcacgcac-3’.ThePCRproducts and the vector encoding the carboxy-terminal ... 5’-gatatccctgacagtatt- gaacctgtcc-3’, Orf_16279 with primers 5’-gggcccggatcc- gaggtcatgcgc-3’ and 5’-gatatcagaaaggcgtctctgcgtcaaaac-3’, Orf_101534 with primers 5’-gggcccg gcct gact...
Ngày tải lên: 09/08/2014, 23:20
Báo cáo y học: " Polychromatic immunophenotypic characterization of T cell profiles among HIV-infected patients experiencing immune reconstitution inflammatory syndrome (IRIS)" doc
... Quantibrite (HB7); CD8 Alexa700 (RPA-T8); CD27 APC (L128); CD57 FITC (HNK-1); CD3 AmCyan (SK7); CD4 PerCP Cy5.5 (SK3) (BD Biosciences, CA, USA); CD45RO ECD (UCHL1, Beckman Coulter, France) and vAmine ... Research and Therapy Open Access Research Polychromatic immunophenotypic characterization of T cell profiles among HIV-infected patients experiencing immune reconstitution inflammat...
Ngày tải lên: 10/08/2014, 05:21
Báo cáo y học: "IVBrainSeqDB: a database of annotated HIV envelope sequences from brain and other anatomical sites" ppt
... Gartner S, Liu Y, Burgon TB, Estes JD, Thacker TC, Crandall KA, McArthur JC, Burton GF: Characterization of the follicular dendritic cell reservoir of human immunodeficiency virus type 1. J Virol 2008, ... inhibitor. Virology 2006, 346:169-179. 27. Li Y, Kappes JC, Conway JA, Price RW, Shaw GM, Hahn BH: Molecular characterization of human immunodeficiency virus type 1 cloned d...
Ngày tải lên: 10/08/2014, 05:21
Báo cáo y học: "An interesting journey of an ingested needle: a case report and review of the literature on extraabdominal migration of ingested Foreign bodies" pdf
... most common causes of foreign body ingestion are accidental swallowing of objects. Children usually put any object they find into their mouths and may acciden- tally swallow them. In healthy adults, ... have any symptoms or signs of peritonitis. An emergent computerized tomography (CT) confirmed * Correspondence: mkement@yahoo.com 1 General Surgery Department, Kartal Education and R...
Ngày tải lên: 10/08/2014, 09:21
Báo cáo y học: " A meta-analysis of gemcitabine containing chemotherapy for locally advanced and metastatic pancreatic adenocarcinoma" ppsx
... Society of Clinical Oncology (ASCO) and the European Cancer Conference (ECCO) were included. Selection criteria To be eligible for inclusion, trials were required to be prospective, properly randomized ... J, Ma Y, Wang H: Capecitabine-based chemotherapy for metastatic colorectal cancer. J Cancer Res Clin Oncol 2010. 48. Cartwright TH, Cohn A, Varkey JA, Chen YM, Szatrowski TP, Cox JV, S...
Ngày tải lên: 10/08/2014, 21:23
Báo cáo y học: "An unusual case of autoimmune pancreatitis presenting as pancreatic mass and obstructive jaundice: a case report and review of the literature" pot
... especially in young patients. Clinical suspi- cion of the entity is critical. Clinical experience and refinement of diagnostic criteria may help in the differ- entiation of this entity from pancreatic ... Hematology and Oncology & Department of Medicine, College of Human Medicine, Michigan State University, East Lansing, MI, USA. 5 Department of Hematology and Medical On...
Ngày tải lên: 10/08/2014, 23:21
Báo cáo y học: " Solitary metastatic adenocarcinoma of the sternum treated by total sternectomy and chest wall reconstruction using a Gore-Tex patch and myocutaneous flap: a case report" docx
... left side mastectomy followed by CEF (cyclophosphamide, epirubin and fluorouracil) chemotherapy and radiother- apy. The clinical and histological characteristics of the primary breast cancer reveale ... 4:75 http://www.jmedicalcasereports.com/content/4/1/75 Page 4 of 8 CAS E REP O R T Open Access Solitary metastatic adenocarcinoma of the sternum treated by total sternectomy and...
Ngày tải lên: 11/08/2014, 11:23
Báo cáo y học: "A severe case of erythrodermic psoriasis associated with advanced nail and joint manifestations: a case report" pptx
... any notable improvement. Conclusion Our case report illustrates clinical features that are not commonly described and reported in severe cases of erythrodermic psoriasis, including severe and ... malignancies such as lymphoma and mycosis fungoi- des which can be clinically indistinguishable from a severe form of psoriasis. Histopathological studies are also generally needed to achie...
Ngày tải lên: 11/08/2014, 12:20