Báo cáo y học: " A novel adenovirus of Western lowland gorillas (Gorilla gorilla gorilla)" ppt

... CTCGGTATCGTTGACGGC 4662-as GATCAACGGGCACAAAGC 10044 bp 60°C Primers specific for AdV species B Hex-loop2 Hexon 5442s GAACAAGATACTTTAGCATGTGGAA 5442as GATTGAATGGATTAACATTGTCC 468 bp 55°C Hexon 5443s TAGAAAATCACGGGGTGGAAGA 5443as ... Western lowland gorilla + + Gorilla gorilla adenovirus B8 GgorAdV-B8 HQ292615 Western lowland gorilla + + Gorilla gorilla adenovirus B9 GgorAdV...

Ngày tải lên: 12/08/2014, 02:20

... W, 5¢-TTCAATGTGTCTGATTGGGCAGCTCTACTAGA AAAGGCTG-3¢; for E318 to I, 5¢-CAATGTGTCTGA TATAGCAGCTCTACTAGAAAAG-3¢; for E318 to R, 5¢-CAATGTGTCTGATCGAGCAGCTCTACTAGAAA AG-3¢; for E318 to Y, 5¢-CAATGTGTCTGATTATGCA GCTCTACTAGAAAAG-3¢. ... : a case con trol study. Lancet 353, 351–353. 20. Matsubara, Y. , Mur ata, M., Maruyama, T., Handa, M., Yamagata, N ., Watanabe, G ., Saruta, T. & Ikeda, Y....

Ngày tải lên: 08/03/2014, 22:20

... src="data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAA94AAAWQCAIAAAAjjQtaAAAACXBIWXMAABYlAAAWJQFJUiTwAAAYCUlEQVR42uzYMRUAIAxDQcqMTVzhNV3w0OVOQqb/Uue+BQAATNsmAAAAaQ4AAHyVxAoAADDOaw4AANIcAACQ5gAAIM0BAABpDgAA0hwAAJDmAAAgzQEAAGkOAADSHAAAkOYAACDNAQAAaQ4AANIcAACQ5gAAIM0BAABpDgAA0hwAAJDmAAAgzQEAAGkOAADSHAAAkOYAACDNAQAAaQ4AANIcAACQ5gAAIM0BAABpDgAA0hwAAJDmAAAgzQEAAGkOAABIcwAAkOYAAIA0BwAAaQ4AAEhzAACQ5gAA...

Ngày tải lên: 08/08/2014, 18:20

... rare- faction and osteolysis. Sclerosis may appear later. A tech- netium bone scan shows increased uptake and may facilitate an earlier diagnosis. In three patients, diagnosis was made only after ... physical activity. In most of the 18 other patients, diagnosis was delayed. The average time from the start of symptoms to diagnosis was 13 days (range 1 to 30 days). Changes in plain radio...

Ngày tải lên: 11/08/2014, 21:22

Ngày tải lên: 13/08/2014, 15:21

... expressed as mean ± SD (standard deviation) and analyzed by one way analysis of variances (ANOVA) followed by Tukey's multiple comparison test. Statistical analysis was performed with the GraphPad ... Energy Authority, Nasr City, Cairo, Egypt Email: Ola Ali Gharib - drolagharib@yahoo.com Abstract Background: Trichloroethylene (TCE) may induce oxidative stress which generates free radi...

Ngày tải lên: 13/08/2014, 15:21

... respiratory muscle strength) and a novel mecha nism of action (reduced calpain activation) [1].  e implication of this work is that administration of EPA may be able to decrease the respiratory, and ... EPA might attenuate the loss of muscle strength through a variety of actions: EPA has been shown to act as a weak antioxidant [3], to inhibit proteasomes [4,5], to in...

Ngày tải lên: 13/08/2014, 20:21

... DEPC water. The quality and quantity of th e isolated RNA was evaluated using the 2100 Bio- analyzer™ (Agilent Technologies, Palo Alto, CA, USA). cDNA synthesis First strand cDNA synthesis was performed ... hours at 45°C. Chips were then washed, stained with streptavidin phycoerythrin and scanned on the Agilent Gene Array Scanner™ (Agilent Technologies). Analysis of microarray data We com...

Ngày tải lên: 13/08/2014, 21:21

... analysis using a novel microsatel- lite in essential hypertension. Am J Hypertens. 1999; 12: 1144-8. 26. Takahashi Y, Nakayama T, Soma M, Izumi Y, Kanmatsuse K. Organization of the human natriuretic ... Association of 5' upstream promoter region of prostacyclin synthase gene variant with cerebral infarction. Am J Hypertens. 2000; 13: 1263-7. 16. Morita A, Nakayama T, So...

Ngày tải lên: 26/10/2012, 10:04

... those of extradiol dioxygenases available in the FASTA AND BLAST database programs at the DNA Data Bank of Japan. The gene encoding 4-amino-3-hydrox- ybenzoate 2,3-dioxygenase is currently being ... 6-amino-m-cresol and 2,5- pyridinedicarboxylic acid were purchased from Tokyo Kasei Kogyo (Tokyo, Japan), meat extract (Extract Ehlrich) was from Kyokuto Seiyaku Kogyo (Osaka, Japan) and 4-ami...

Ngày tải lên: 21/02/2014, 01:21