Báo cáo y học: "Hepatitis C Treatment: current and future perspectives" doc

... affects [17,12]. As HCV is mainly a chronic disease and progress very slowly there- fore persistent infection is a typical characteristic of dis- ease which can be found i n approximately 75% ... personality changes, even suicide, depression or acute psychosis. Ribavirin side effect included anemia, renal dysfunction of coronary artery. Fetal abnormality and fatality are important side ef...

Ngày tải lên: 12/08/2014, 02:20

... therapy. Virological tools include serological assays for anti-HCV antibody detection and serological determination of the HCV genotype, and molecular assays that detect and quantify HCV RNA and ... reaction (PCR), “real-time” PCR or TMA [5]. HCV RNA is extracted and reverse transcribed into a double stranded complementary DNA (cDNA), which is subsequently processed into a cycl...

Ngày tải lên: 02/11/2012, 09:56

... directly injure the liver but it rather triggers an HCV-specific lymphoproliferation. Through profuse cytokine production and also a direct cytopathic effect, these T cells result in hepatocyte ... distribution and size of the lipid accumulation within the hepatocytes. Microvesicular steatosis that is seen in Reye’s syndrome and Acute Fatty Liver Disease of Pregnancy occurs due t...

Ngày tải lên: 02/11/2012, 09:51

... Sci. 2006, 3 60 6. Dual Infection of HBV and HCV and hepatocellular carcinoma (HCC) HBV and HCV infections are confirmed causes of HCC. What’s the combined effect of HBV and HCV coinfection ... on HCC? Accumulated epidemiological data suggested that coinfection with HBV and HCV could increase the risk for development of HCC. A case-control study [51] conducted in Qidong coun...

Ngày tải lên: 02/11/2012, 09:51

... gel as DNA size marker and the HCV genotype for each sample was confirmed by HCV genotype-specific PCR band. Gel documentation system (Geldoc System, Eppendorf Inc, Germany) was used for gel photograph. ... Ahmed 3 Abstract Hepatitis C virus (HCV) is the leading cause of chronic hepatitis worldwide and its subtypes/genotypes are clinically important for clinical management and vaccine...

Ngày tải lên: 11/08/2014, 21:21

... peer review • No space constraints or color figure charges • Immediate publication on acceptance • Inclusion in PubMed, CAS, Scopus and Google Scholar • Research which is freely available for redistribution Submit ... by the Ethical Commit- tee of the Materno Infantil Hospital in Goiânia city, Goiás state. The participa nts were interviewed to collect socio-demographic data and possible ri...

Ngày tải lên: 12/08/2014, 04:20

... Sopanen, R. Tyni, and V. Mäkinen for excellent technical assistance. This study was funded in part by the Medical Research Council of the Acad- emy of Finland, the Finnish Cancer Foundation and the ... immediately upon acceptance cited in PubMed and archived on PubMed Central yours — you keep the copyright Submit your manuscript here: http://www.biomedcentral.com/info/publishing_adv.a...

Ngày tải lên: 12/08/2014, 04:21

... 5'-GTACGGGGATCCTTATCAG- CACTCTTCCATCTCATCGAACTCCTG-3', F gene; 5'- AAAAAAAAGGATCCACCATG GCACGAATCCTAAACCT- CAAAGA-3', 5'-TTTCCCTGGGATCCTTATCACGCCGTCT- TCCAGAACCCG-3' (initiation codon ... 5'- GCAACGCGTCATATTCCTGAGTCCTTCCTTGC-3' and 5'- CCCGGTACCGTCTGTGTCACAGAGAGAAAGGGAG-3' (for IFN-λ3 promoter), 5'-ATGACGCGTGAAATTCAG- GAGTAATCAGATC-3&ap...

Ngày tải lên: 20/06/2014, 01:20

... cytotoxic agents in WG. The efficacy of these approaches remained uncertain until 1973, when Fauci and Wolff explored the immunologic and clinical effects of CYC and glucocorti- coids in WG [2]. CYC ... given Transitional cell carcinoma of the bladder Urinalysis every 3–6 months Cytology every 6 months Cystoscopy in patients with nonglomerular hematuria or abnormal cytology If bladder i...

Ngày tải lên: 09/08/2014, 01:22

... respectively[7,8]. Recently, geno- type G was identified in the USA and France[9]. Geno- type H was also recently found in Central America[10]. The genotypes and subtypes are useful clinical and ... a correla- tion between the molecular characteristics of the HBV virus with which a patient was infected and their clinical characteristics. We also verified the frequency of precore and...

Ngày tải lên: 12/08/2014, 04:20