Báo cáo y học: " A duplex real-time reverse transcriptase polymerase chain reaction assay for detecting western equine and eastern equine encephalitis viruses?" docx
Báo cáo y học: " A duplex real-time reverse transcriptase polymerase chain reaction assay for detecting western equine and eastern equine encephalitis viruses?" docx
... veloped an RT-PCR assay for alphavirus detection[13]. Pässler et al. developed a detecting assay for alphaviruses based on antibodies [14]. Lambert et al. developed an RT-PCR assay and Taqman RT-PCR ... duplex TaqMan real-time reverse transcrip- tase polymerase chain reaction (RT-PCR) assay, which can be used in human and vector surveillance. First, we selected...
Ngày tải lên: 12/08/2014, 01:22
Báo cáo y học: "A single-tube allele specific-polymerase chain reaction to detect T315I resistant mutation in chronic myeloid leukemia patients" pdf
... (5’-tggttcatcatc attcaacggtgg-3’ ) and reverse primers: abl_1R (5’-tctgagtggccatgtacagcagc-’3), and fragment 2 forward primers: abl_2F (5’-tcatgacc- tacgggaacctc-3’) and reverse primers: abl_1R (5’-atactc- caaatgcccagacg-’3). ... -TGGTTCATCATCATTCAACGGTGG-3’ ) and WT_R (5’ -GTTCCCGTAGGTCATGAACTCAG- 3’), and 3) internal control primers, forward (b-actin_F) (5’ -gtggggcgccccaggcac...
Ngày tải lên: 10/08/2014, 21:23
Báo cáo y học: " A novel duplex real-time reverse transcriptase-polymerase chain reaction assay for the detection of hepatitis C viral RNA with armored RNA as internal control" docx
... considerably lower than that of the CAP/CTM assay, and hence, the former assay is more suitable for large-scale use. Conclusions The duplex real-time RT-PCR assay is comparable with the CAP/CTM assay ... Chevaliez S, Bouvier-Alias M, Castéra L, Pawlotsky JM: The Cobas AmpliPrep-Cobas TaqMan real-time polymerase chain reaction assay fails to detect hepatitis C virus...
Ngày tải lên: 12/08/2014, 04:20
Báo cáo y học: "Multiplex Amplification Refractory Mutation System Polymerase Chain Reaction (ARMS-PCR) for diagnosis of natural infection with canine distemper virus" potx
... primers CDF-F: 5'-AGAGTGCAAAATAGTAA- GAATCCAAGC-3' and CDF-R: 5'-GAAAGAGACTG- GCTATTCCGATGC-3', which amplified a fragment containing the M gene (115 downstream nucleotides; 4325-4439), ... The primers used for field strain amplification were F-wt: 5'- AATTCCCAAAAAATCCAAACCCTGC-3' and R-wt: 5'-GATTGCCGCCTCTTGAACCAGGAA-3'. The amplification condi...
Ngày tải lên: 12/08/2014, 04:20
Báo cáo y học: "Diagnostic value of real-time polymerase chain reaction to detect viruses in young children admitted to the paediatric intensive care unit with lower respiratory tract infection" pptx
... LJ, van Loon AM, van der Beek A, Hendriksen KA, Hoepelman AI, van Kraaij MG, Schipper P, Nijhuis M: Applicability of a real-time quantitative PCR assay for diagnosis of respira- tory syncytial ... Rapid simultaneous diagno- sis of infections with respiratory syncytial viruses A and B, influenza viruses A and B, and human parainfluenza virus types 1, 2, and 3 by multiplex...
Ngày tải lên: 12/08/2014, 23:23
Báo cáo y học: " A mouse model to study infection against porcine circovirus type 2: viral distribution and lesions in mouse" docx
... the ShanDong Academy of Agricultural Sciences Great Innovation Fund (2007YCX017-04) and the ShanDong Academy of Agricultural Sciences Youth Fund (2006YQN033). The authors thank Ms. Sara and Dr ... of Swine Diseases, Shandong Provincial Key Laboratory of Animal Disease Control & Breeding, Institute of Animal Science and Veterinary Medicine Shandong Academy of Agricultural Sciences, J...
Ngày tải lên: 12/08/2014, 04:20
Báo cáo y học: " A formylpeptide receptor, FPRL1, acts as an efficient coreceptor for primary isolates of human immunodeficiency virus" docx
... Ishikawa K, Tsujimoto H, Nakai M, Mingle AJ, Osei-Kwasi M, Aggrey SE, Nettey VB, Afoakwa SN, Fukasawa M, Kodama T: Isolation and characterization of HIV-2 from an AIDS patient in Ghana. AIDS ... [NM000579 ]. CXCR4: CXCR4CN, 5'-ATGGAGGGGATCAGTATATA- CACTTCAGAT-3' (sense: 1st–30th); and CXCR4CR, 5'- 'TTAGCTGGAGTGAAAACTTGAAGACTCAGA-3' (anti- sense, 979–1,008th) [NM00...
Ngày tải lên: 13/08/2014, 05:21
Báo cáo y học: "A simpler method of preprocessing MALDI-TOF MS data for differential biomarker analysis: stem cell and melanoma cancer studies" pptx
... effectively remove all types of uncertainty in the raw MS data so that data reproducibility and spectral comparison can be per- formed. A lack of standard procedures for “cleaning” the raw MS data results ... These ion panels achieved over 90% classification accuracy on blind validation data. Receiver operating characteristics analysis was performed and the area under the curve for...
Ngày tải lên: 13/08/2014, 13:21
Báo cáo y học: "A third-generation microsatellite-based linkage map of the honey bee, Apis mellifera, and its comparison with the sequence-based physical map" pps
... its 'domestic' status, artificial selection remains very marginal and probably does not reinforce drift, mainly because of its small 'natural' effective population size. Another ... http://genomebiology.com/2007/8/4/R66 Genome Biology 2007, 8:R66 assemblies. The simultaneous availability of genetic and physical data also provided the opportunity for mutual qual- ity...
Ngày tải lên: 14/08/2014, 07:21
Báo cáo khoa học: " Development of a fluorescent quantitative real-time polymerase chain reaction assay for the detection of Goose parvovirus in vivo" ppsx
... GTGCCGATGGAGTGGGTAAT 3084-3103 60 GPV-R ACTGTGTTTCCCATCCATTGG 3122-3143 GPV-FP 6FAM-FTCGCAATGCCA ATTTCCCGAGGP TAMRA 3098-3120 VP3-1 AAGCTTTGAAATGGCAGAGGGAGGA 3008-3033 1658 VP3-2 GGATCCCGCCAGGAAGTGCTTTATTTGA ... 1995, 210:283-291. 3. Fang DY: Recommendation of GPV. Veterinary Science in China 1962, 8:19-20. (in chinese). 4. Takehara K, Nishio T, Hayashi Y, Kanda J, Sasaki M, Abe N, Hiraizumi...
Ngày tải lên: 12/08/2014, 04:20