Báo cáo y học: " A duplex real-time reverse transcriptase polymerase chain reaction assay for detecting western equine and eastern equine encephalitis viruses?" docx

... veloped an RT-PCR assay for alphavirusdetection[13]. Pässler et al. developed a detecting assay for alphaviruses based on antibodies [14]. Lambert et al.developed an RT-PCR assay and Taqman RT-PCR ... duplex TaqMan real-time reverse transcrip-tase polymerase chain reaction (RT-PCR) assay, which can be used in human and vector surveillance. First, weselected the primers and FAM-labeled TaqMan-probe ... transcriptase polymerase chain reaction assay for detecting western equine and eastern equine encephalitis virusesXiaoping Kang, Yuchang Li, Hong Liu, Fang Lin, Xuyu Cai, Tingting Sun, Guohui Chang, Qingyu Zhu,...

Báo cáo y học: "A single-tube allele specific-polymerase chain reaction to detect T315I resistant mutation in chronic myeloid leukemia patients" pdf

... (5’-tggttcatcatc attcaacggtgg-3’ ) and reverse primers: abl_1R (5’-tctgagtggccatgtacagcagc-’3), and fragment 2 forward primers: abl_2F (5’-tcatgacc-tacgggaacctc-3’) and reverse primers: abl_1R (5’-atactc-caaatgcccagacg-’3). ... -TGGTTCATCATCATTCAACGGTGG-3’ ) and WT_R (5’ -GTTCCCGTAGGTCATGAACTCAG-3’), and 3) internal control primers, forward (b-actin_F)(5’ -gtggggcgccccaggcacca-3’ )andb-act in_R (5’ -gtccttaatgtcacgcacgatttc-3’ ... pmol of each primers(forward primers: B 2A _f 5’-acagcattccgctgaccatcaataag-3’ and reverse primer: BA_r 5’-atggtccagaggatcgct ctct-’ 3)[8]. The reaction mixture was placed in a thermal cycler(Veriti,...

Báo cáo y học: " A novel duplex real-time reverse transcriptase-polymerase chain reaction assay for the detection of hepatitis C viral RNA with armored RNA as internal control" docx

... considerably lower than thatof the CAP/CTM assay, and hence, the former assay ismore suitable for large-scale use.ConclusionsThe duplex real-time RT-PCR assay is comparable withthe CAP/CTM assay ... Chevaliez S, Bouvier-Alias M, Castéra L, Pawlotsky JM: The Cobas AmpliPrep-Cobas TaqMan real-time polymerase chain reaction assay fails to detect hepatitis C virus RNA in highly viremic genotype ... 10.1186/1743-422X-7-117Cite this article as: Meng and Li, A novel duplex real-time reverse tran-scriptase -polymerase chain reaction assay for the detection of hepatitis C viral RNA with armored RNA as internal control...

Báo cáo y học: "Multiplex Amplification Refractory Mutation System Polymerase Chain Reaction (ARMS-PCR) for diagnosis of natural infection with canine distemper virus" potx

... primers CDF-F: 5'-AGAGTGCAAAATAGTAA-GAATCCAAGC-3' and CDF-R: 5'-GAAAGAGACTG-GCTATTCCGATGC-3', which amplified a fragmentcontaining the M gene (115 downstream nucleotides;4325-4439), ... Theprimers used for field strain amplification were F-wt: 5'-AATTCCCAAAAAATCCAAACCCTGC-3' and R-wt:5'-GATTGCCGCCTCTTGAACCAGGAA-3'. Theamplification conditions for the multiplex-nested ... al.: Broadly reactive pan-paramyxovirus reverse transcription polymerase chain reaction and sequence analysis for the detection of Canine distemper virus in a case of canine meningoencephalitis...

Báo cáo y học: "Diagnostic value of real-time polymerase chain reaction to detect viruses in young children admitted to the paediatric intensive care unit with lower respiratory tract infection" pptx

... LJ, van Loon AM, van der Beek A, Hendriksen KA,Hoepelman AI, van Kraaij MG, Schipper P, Nijhuis M: Applicabilityof a real-time quantitative PCR assay for diagnosis of respira-tory syncytial ... Rapid simultaneous diagno-sis of infections with respiratory syncytial viruses A and B,influenza viruses A and B, and human parainfluenza virustypes 1, 2, and 3 by multiplex quantitative reverse ... coronaviruses (OC43,229E and the newly identified coronavirus NL63 [31]) and theatypical pathogens Mycoplasma pneumoniae and Chlamydiapneumoniae. Thus, real-time PCR allows for maximal detec-tion...

Báo cáo y học: " A mouse model to study infection against porcine circovirus type 2: viral distribution and lesions in mouse" docx

... the ShanDong Academy of Agricultural SciencesGreat Innovation Fund (2007YCX017-04) and the ShanDong Academy ofAgricultural Sciences Youth Fund (2006YQN033). The authors thank Ms. Sara and Dr ... ofSwine Diseases, Shandong Provincial Key Laboratory of Animal DiseaseControl & Breeding, Institute of Animal Science and Veterinary MedicineShandong Academy of Agricultural Sciences, Jinan, 250100, ... analysisAll data are presented as means ± SD with SPSS13.0software (SPSS, Chicago, IL, USA). Statistical analyseswere performed by two-way analysis of variance(ANOVA) followed by S-N-K posthoc...

Báo cáo y học: " A formylpeptide receptor, FPRL1, acts as an efficient coreceptor for primary isolates of human immunodeficiency virus" docx

... Ishikawa K, Tsujimoto H, Nakai M, Mingle AJ, Osei-Kwasi M, AggreySE, Nettey VB, Afoakwa SN, Fukasawa M, Kodama T: Isolation and characterization of HIV-2 from an AIDS patient in Ghana.AIDS ... [NM000579].CXCR4: CXCR4CN, 5'-ATGGAGGGGATCAGTATATA-CACTTCAGAT-3' (sense: 1st–30th); and CXCR4CR, 5'-'TTAGCTGGAGTGAAAACTTGAAGACTCAGA-3' (anti-sense, 979–1,008th) [NM003467]. ... 5'-ATGGAAGATTTGGAG-GAAACATTATTTGAA-3' (sense, 1st–30th); and GPR1CR,5'-TTATTGAGCTGTTTCCAGGAGACACAGATT-3' (anti-sense, 1,039th–1,068th) [U13666].Detection of GPCR mRNATotal RNA...

Báo cáo y học: "A simpler method of preprocessing MALDI-TOF MS data for differential biomarker analysis: stem cell and melanoma cancer studies" pptx

... effectively remove all types of uncertainty inthe raw MS data so that data reproducibility and spectral comparison can be per-formed. A lack of standard procedures for “cleaning” the raw MS data results ... These ionpanels achieved over 90% classification accuracy on blind validation data. Receiveroperating characteristics analysis was performed and the area under the curve for melanoma and cord ... different sample types(i.e. serum and plasma), were use d. These data sets comprised melanoma sera datacategorised into stage 2 and stage 3 diseases, and cord blood plasma labelled based onthe quantity...

Báo cáo y học: "A third-generation microsatellite-based linkage map of the honey bee, Apis mellifera, and its comparison with the sequence-based physical map" pps

... its'domestic' status, artificial selection remains very marginal and probably does not reinforce drift, mainly because of itssmall 'natural' effective population size.Another ... http://genomebiology.com/2007/8/4/R66Genome Biology 2007, 8:R66assemblies. The simultaneous availability of genetic and physical data also provided the opportunity for mutual qual-ity control and to reach a ... taken separately and together (maps B, V, and combined). They were all saturated and as the order of mark-ers in common was the same in maps taken pairwise, thecombined map will be the only...

Báo cáo khoa học: " Development of a fluorescent quantitative real-time polymerase chain reaction assay for the detection of Goose parvovirus in vivo" ppsx

... GTGCCGATGGAGTGGGTAAT 3084-3103 60GPV-R ACTGTGTTTCCCATCCATTGG 3122-3143GPV-FP 6FAM-FTCGCAATGCCAATTTCCCGAGGP TAMRA3098-3120VP3-1 AAGCTTTGAAATGGCAGAGGGAGGA 3008-3033 1658VP3-2 GGATCCCGCCAGGAAGTGCTTTATTTGA ... 1995,210:283-291.3. Fang DY: Recommendation of GPV. Veterinary Science in China1962, 8:19-20. (in chinese).4. Takehara K, Nishio T, Hayashi Y, Kanda J, Sasaki M, Abe N, HiraizumiM, Saito S, Yamada T, Haritani ... Alexandrova R, Alexandrov I, Zacharieva S, LasarovaS, Doumanova L, Peshev R, Donev T: Fluorescent and electron-microscopy immunoassays employing polyclonal and mono-clonal antibodies for detection...

Xem thêm