Báo cáo y học: " Analysis of a new strain of Euphorbia mosaic virus with distinct replication specificity unveils a lineage of begomoviruses with short Rep sequences in the DNA-B intergenic region" pdf
... this article as: Gregorio-Jorge et al.: Analysis of a new strain of Euphorbia mosaic virus with distinct replication specificity unveils a lineage of begomoviruses with short Rep sequences in the ... represent actual replicating lineages, and replication- incompatible strains, that apparently do not. What is the function of the DNA-B sR...
Ngày tải lên: 12/08/2014, 01:22
... daily at the time of analysis. After developing parotid gland enlargement, lymphoma of the parotid gland was excluded by partial parotidectomy and histo- logical examination. After approval by the ... disease was 9 years at the time of analysis. The patient expressed elevated titers of anti-52 kDa Ro(SS -A) and anti-52 kDa La(SS-B) antibodies, had marked hyper- gammaglobu...
Ngày tải lên: 09/08/2014, 03:24
... susceptibility One advantage of the HTR framework for analysis of haplo- types is that other factors can be included in the model. The analysis was repeated including the RA-associated 'shared epitope' ... JR and VK undertook some of the genotyping assays on DNA prepared in the laboratory of EAJ and RWO, who partic- ipated in the original design of...
Ngày tải lên: 09/08/2014, 07:20
Báo cáo y học: "Analysis of TNFAIP3, a feedback inhibitor of nuclear factor-κB and the neighbor intergenic 6q23 region in rheumatoid arthritis susceptibility" pot
... and in the analysis and interpretation of results. JJG-R coordinated the acquisition of clinical data and collection of samples, and participated in the analysis and interpretation of results. AG ... participated in the design of the study and in the coordination of acquisition of clinical data and collection of samples, and supervised genotyping, stati...
Ngày tải lên: 09/08/2014, 14:20
Báo cáo y học: " Analysis of the PDZ binding specificities of Influenza A Virus NS1 proteins" ppt
... data obtained from single domain assays should be treated with caution. We had previously shown by crystallographic and mutational analysis that the specificities of type 1 PDZ- binding interactions ... affinity for Dlg. Upper panel. The cartoon shows the last 11 amino acid residues of Avian (A) and Human (H) NS1, together with the non-PDZ-binding mutant of Avian NS1 (Aa),...
Ngày tải lên: 11/08/2014, 21:21
Báo cáo y học: "Analysis and evaluation of environmental tobacco smoke exposure as a risk factor for chronic cough" docx
... ETS and the symptom of cough has not been analysed in great detail so far. There- fore, the present study aimed to analyse the association of ETS and cough on the basis of database searches and ... been analysed in detail previously. Therefore, a recent study assessed the correlation of ETS exposure with the expression of inflam- matory mediators in airway secr...
Ngày tải lên: 13/08/2014, 08:20
Báo cáo y học: " Analysis of the replication of HIV-1 forced to use tRNAMet(i) supports a link between primer selection, translation and encapsidation" ppsx
... 5'cgcccgaacagggacttgaaccctgg accctcagattaaaagtctgat- gctctaccgactgagctatccgggc 3' (tRNA Lys,3 ); 2. 5' aattTAATACGACTCACTATAGGcctcgttagcgcagtagg 3' and 5' tgccccgtgtgaggatcgaactcacg accttcagattatgagact- gacgcgctacctactgcgctaacgagg ... accttcagattatgagact- gacgcgctacctactgcgctaacgagg 3 (tRNA Met(e) ); 3. 5' aattTAATACGACTCACTATAGGagcagagtggcgcagcgg 3' and 5&a...
Ngày tải lên: 13/08/2014, 09:20
Báo cáo y học: "Analysis of N-terminal pro-B-type natriuretic peptide and cardiac index in multiple injured patients: a prospective cohort study" docx
... normal as an indicator for intravascular vol- ume loss and therefore as an initial marker of bleeding. Stewart and colleagues [4] recently analyzed BNP and transthoracic echocardiogram in trauma ... correlate with a decreased CI as a parameter for cardiovascular function. The data of this pilot study may indicate a potential value of NT- proBNP in the diagnosis of post...
Ngày tải lên: 13/08/2014, 11:22
Báo cáo y học: " Analysis of 14 BAC sequences from the Aedes aegypti genome: a benchmark for genome annotation and assembly" docx
... and sequencing. This benchmark analysis of the Aedes genome has yielded a set of manually annotated transcripts that has been validated with molecular and comparative data. In addition, we have presented ... data that may clarify the origin of duplicated tran- scripts in the genome assembly. BAC assembly The quality of these BAC assemblies is critical for a valid a...
Ngày tải lên: 14/08/2014, 07:21
Báo cáo y học: "Analysis of gene expression in a developmental context emphasizes distinct biological leitmotifs in human cancers" pdf
... thyroid carcinoma 1 CT Papillary thyroid carcinoma 1 TC Early stage HCC Myeloma CRCC 1 T−cell lymphoma Papillary thyroid carcinoma 1 FV UBC 1 Lung adenocarcinoma Advanced HCC Colorectal adenoma Wilms ... group repre- sents 46% of all datasets and contains tumors from a diversity of anatomical locations, including lung carcinomas, bladder cancers, hepatocellular carcinomas and the hema...
Ngày tải lên: 14/08/2014, 20:22