Báo cáo y học: "Characterization of an H3N2 triple reassortant influenza virus with a mutation at the receptor binding domain (D190A) that occurred upon virus transmission from turkeys to pigs" potx

... was employed to evaluate the cross reactivity between paren- tal(190Asp)andHA-mutant(190Ala)TK04viruses. Additionally, cross reactivity was evaluated between TK04 parental and mutant viruses, and other ... turkey H3N2 influenza isolates. More work is needed to evaluate the replication and antigenicity of 190Ala mutation in vivo . Addition- ally, it is of importance to see...

Ngày tải lên: 12/08/2014, 01:22

... GTTGTCGACAAA CATCTCAACTAG-3 and GSTX3: 5¢-GTAAGTGTGG GAATAAGATCAAATC from adult S. mansoni reverse- transcribed RNA. The product of the PCR was sequenced and used as probe to screen an adult worm ... blot analysis was performed in order to ascertain that the cloned sequence belonged to the parasite and was not due to an artifact, and also to examine the copy numb...

Ngày tải lên: 21/02/2014, 01:21

... The viral polymerase mediates adaptation of an avian influenza virus to a mammalian host. Proc Natl Acad Sci USA 2005, 102:18590-18595. 19. Hatta M, Gao P, Halfmann P, Kawaoka Y: Molecular basis ... important component in the transmission cycle of avian influenza virus. Monitoring the water at aggregation and breeding sites of migratory waterfowl, mainly wetland,...

Ngày tải lên: 11/08/2014, 21:22

... 5′- agcttttccaaaaaaagctcatcggaactgacaatctcttgaattgtcagttcc- gatgagctg-3′; PRE 1329 5′-gatccgctgacaattctgtcgtcctttcaa- gagaaggacgacagaattgtcagttttttggaaa-3′ ; AtPRE1329 5′- agcttttccaaaaaactgacaattctgtcgtccttctcttgaaaggacgaca- gaattgtcagcg-3′. ... amplification oftheSAsequence(forward:SAF_XhoI5′-gaattcctcga- gagaccaatagaaactgggc-3′, reverse: SAR_EcoRV 5′-gaattc- gatatccctgtggagagaaaggcaaagtg-3...

Ngày tải lên: 12/08/2014, 01:21

... strain was calculated as the gradient of the longitudinal displacement (derivative of the displacement) along the ultrasound beam, and the shear strain was cal- culated as the partial derivative ... 11 Since angioplasty is a common treatment for s tenosis and results in ch anges in th e arterial fiber anatomy of the tunica media as the angioplasty balloon expands, we i...

Ngày tải lên: 13/08/2014, 16:20

... cellular activation, proliferation and differ- entiation by means of the janus kinase/signal transducer and activator of transcription (JAK/STAT) pathway [5,6]. The bind- ing of these cytokines to ... of the acute phase of AIA. These data imply that activation of the STAT-1 pathway plays an important role in our Th1 cell-mediated arthritis model. Th1 cell function is...

Ngày tải lên: 09/08/2014, 07:20

... viral hepatitis, commercial sex work, risk factors of the patient’s last regular sexual partner(s), and medical care-related risk factors (e.g., history of invasive medical manipulations and ... identified from the HIV/ AIDS surveillance database. HCV status was available for 244 women. Because of substantial missing data, analyses were genera lly limited to 228 women. Women wi...

Ngày tải lên: 10/08/2014, 05:22

... of pravas- tatin is open hydroxyl-acid so that its hydrophilicity is markedly higher than that of other statins. The oral bioavailability of this statin is low due to degradation in the stomach ... Magnification is X5000. Figure 4, Percent of pravastatin and hemoglobin release from loaded erythrocytes in PBS and plasma. Data were tested by one-way analysis of vari...

Ngày tải lên: 25/10/2012, 11:10

... coevaporation with methanol, the mixture of partially methylated alditols was acetylated with acetic anhydride (3 h, 120 °C), and analyzed by GLC and GLC–EIMS [14,19]. NMR spectroscopy Prior to NMR analysis, ... spectrometric and NMR analyses of the oligosaccharide obtained from the polysac- charide by de-N-acetylation followed by deamination and reduction demonstrated the...

Ngày tải lên: 08/03/2014, 09:20

... Edamoto 5 , Naoto Aiba 6 and Tetsutaro Sata 1 1. Department of Pathology, National Institute of Infectious Diseases, Tokyo, Japan 2. Department of Transplantation Surgery, Nagoya University ... Hospital, Aichi, Japan 3. Department of Transplantation Surgery, Kyoto University Hospital, Kyoto, Japan 4. Institute of Biomedical Research and Innovation, Hyogo, Japan 5. Departme...

Ngày tải lên: 26/10/2012, 10:03