Báo cáo y học: "Use of a highly sensitive strand-specific quantitative PCR to identify abortive replication in the mouse model of respiratory syncytial virus disease" pptx
... this article as: Bannister et al.: Use of a highly sensitive strand- specific quantitative PCR to identify abortive replication in the mouse model of respiratory syncytial virus disease. Virology ... sense ATA GAATTCGGTATGTTATATGCGATGTCTAGGT 1 In vitro standard nested positive sense ATAGGATCCTGCTAAGACTCCCCACCGTAA 2 Positive sense RNA-specific cDNA synthes...
Ngày tải lên: 12/08/2014, 01:22
... content and mappability wit h background signal. However, the model estimates sug- gest that input data alone may not explain all of the variability in DNA-seq background. Examination of the relationships ... of the data can be found in Additional file 2. All data were analyzed within ZINBA using 250-bp windows and an additional offsets of 125 bp. The set of covariat...
Ngày tải lên: 09/08/2014, 23:20
... XQ, Gao PS, Arinobu Y, Enomoto T, Kawai M, Sasaki S, Dake Y, Hamasaki N, Sirakawa T, Hopkin JM: Ile50Val variant of IL-4R alpha upregulates IgE synthesis and associates with atopic asthma. Nat ... (PI3-kinase) and the transcription factor STAT6, the latter being a unique substrate for the IL-4R α pathway [17]. After binding of IL-4 and IL-13, activation of the receptor- asso...
Ngày tải lên: 12/08/2014, 18:20
Báo cáo y học: "Aspergillus antigen induces robust Th2 cytokine production, inflammation, airway hyperreactivity and fibrosis in the absence of MCP-1 or CCR2" pptx
... airway reactivity measured four days after the final Aspergillus antigen challenge was similar to reactivity measured at earlier time points (on the same day as the final challenge or one day after the final ... in increased mucus production, we analyzed lung histology by PAS-staining. As shown in Fig. 4A, there was minimal PAS staining in the airway epithelium of control...
Ngày tải lên: 12/08/2014, 18:21
Báo cáo y học: " Endothelial Blood transfusion during cardiac surgery is associated with inflammation and coagulation in the lung: a case control study" pptx
... and agrees with all reported findings and interpretations. ADC was instrumental in the coordination of the study, data gathering and analysis. He read the final version of the manuscript and agrees ... levels of proinflammatory cytokines and bronchoalveolar activation of coagulation and inhibition of fibrinolysis. Transfusion also was asso- ciated with systemic activation...
Ngày tải lên: 14/08/2014, 07:21
Báo cáo hóa học: " Research Article A Fuzzy Color-Based Approach for Understanding Animated Movies Content in the Indexing Task" doc
... uneasiness .The colors are analyzed at a region-based level by taking the spa- tial relationships of the object in the image into account. The proposed system is adapted to the semantic analysis of com- mercials. ... [33]. Another advantage is that the fuzzy sets are based on the concept of uncertainty and better respect the reality which is uncertain. The fuzzy...
Ngày tải lên: 22/06/2014, 00:20
Báo cáo y học: "An annotated cDNA library and microarray for large-scale gene-expression studies in the ant Solenopsis invicta" pot
... relative to the Drosophila genome. Alternatively, these gene categories may simply be biased in cDNA libraries relative to genomes, for instance, because they contain mainly highly or mainly lowly expressed ... tran-scripts, and a corresponding cDNA microarray are described.</p> Abstract Ants display a range of fascinating behaviors, a remarkable level of intra-speci...
Ngày tải lên: 14/08/2014, 17:22
Tài liệu Báo cáo Y học: Use of site-specific recombination as a probe of nucleoprotein complex formation in chromatin Micha Schwikardi and Peter Droge ¨ potx
... nucleosomal organization. Our analysis employing inhibitors of histone deacetylase and topoisomerases revealed that the reactivity of res remained unaffected, even though the transcriptional activity of ... was necessary to analyze recombination on linearized episomal substrates as they better resemble the topology of targets placed in chromatin than circular substrates used...
Ngày tải lên: 22/02/2014, 07:20
Báo cáo y học: "Use of a population-based survey to determine incidence of AIDS-defining opportunistic illnesses among HIV-positive persons receiving medical care in the United States" ppsx
... participating states had laboratory reporting of at least some CD4 counts and viral loads at the time of the study and the third had an estab- lished, clinically-based HIV reporting system that had been ... speak to the importance of having pop- ulation-based measures of clinical outcomes rather than relying on data collected by cohorts based solely in metro- politan areas...
Ngày tải lên: 10/08/2014, 05:20
Báo cáo y học: "Use of WHO clinical stage for assessing patient eligibility to antiretroviral therapy in a routine health service setting in Jinja, Uganda" pdf
... Geoffrey Namara - geoffrey.namara@mrcuganda.org; Christine Nabiryo - cnabiryo@tasouganda.org; Alex Coutinho - acoutinho@idi.co.ug * Corresponding author Abstract In a routine service delivery setting ... testing and evaluation of the utility of plasma viral load prior to initiation of ART to accompany the roll-out of ART. Introduction In developed countries, CD4 count...
Ngày tải lên: 10/08/2014, 05:21