Báo cáo y học: "Seroprevalence of hepatitis B and C virus in HIV-1 and HIV-2 infected Gambians" pps

... products were sequenced using primers spe- cific for the 5′ UTR (KF2 - TTCACGCAGAA AGC GTCTAG and 211-CACTCTCGAGCAC CCTAT- CAGGCAGT) and NS 5b (HCVN S5F2-TATGA TACC CGCTGCTTTGACTCG; HCVNS 5R 2c- CTGG ... disease and hepatocellular carcinoma (HCC), the most frequent cause of < /b> cancer morbidity and mortality worldwide [3]. Hepatitis < /b> C virus (HCV) pro- duces a chronic in...

Ngày tải lên: 12/08/2014, 01:21

... JA, Olinger CM, Charpentier E, Muller CP: Detection of < /b> a new subgenotype of < /b> hepatitis < /b> B virus genotype A in Cameroon but not in neighbouring Nigeria. Clin Microbiol Infect 2010. 20. Bowyer SM, ... desialylated hepatitis < /b> B virus and asialoglycoprotein receptor on hepatocytes may be indispensable for viral binding and entry. J Viral Hepat 2006, 13:11-...

Ngày tải lên: 12/08/2014, 02:20

... results could be obtained by ICT which is usually practiced in Nyala Teaching Hospital blood bank as a preliminary screening test and thereby the risk of < /b> transfusing infected blood and establishment ... role of < /b> hepatitis < /b> B and hepatitis < /b> C viral infec- tions in incidence of < /b> hepatocellular carcinoma in Sudan. Transactions of < /b> the Royal...

Ngày tải lên: 12/08/2014, 04:20

... on the combined effect of < /b> hepatitis < /b> B and C virus infec- tions in causing hepatocellular carcinoma in China. British Journal of < /b> Cancer 2005, 92:607-612. 12. Crespo J, Lozano JL, de la Cruz F, ... with single occult hepati- tis B virus (HBV), single occult hepatitis < /b> C virus (HCV) and occult HBV and HCV dual infection. Journal of < /b> Medica...

Ngày tải lên: 12/08/2014, 04:21

... sequences used in XMRV-specific PCRs Primer Sequence Reference 419F gag ATCAGTTAACCTACCCGAGTCGGAC Lombardi et al, 2009 1154R gag GCCGCCTCTTCTTCATTGTTCT Lombardi et al, 2009 5922F env GCTAATGCTACCTCCCTCCTGG ... PCR 6173 env F GGCATACTGGAAGCCATCATCATC 6173 env R CCTGACCCTTAGGAGTGTTTCC 6173 env probe ATGGGACCTAATTTCC 6682 env F GTGCTGGCTGTGTCTAGTATCG 6682 env R GCAGAGGTATGGTTGGAGTAAGTAC 6682 e...

Ngày tải lên: 12/08/2014, 23:23

... infected by hepatitis < /b> B virus. HDV co-infection or super infection leads to the cirrho- sis of < /b> the liver and finally hepatocellular carcinoma (HCC) or liver canc er [3,5,6,12]. The current study shows ... Parveen 1 Abstract Background: Hepatitis < /b> delta virus (HDV) and Hepatitis < /b> B virus (HBV) co-infection is well known to induce a spectrum of < /b> a...

Ngày tải lên: 12/08/2014, 01:22

... 0.2 137 Cys 0.2 Cys 0.2 Cys 0.2 Cys 0.2 Cys 0.2 Cys 0.2 Cys 0.2 Cys 0.2 Cys 0.2 138 Cys 0.64 Cys 0.64 Cys 0.64 Cys 0.64 Cys 0.64 Cys 0.64 Cys 0.64 Cys 0.3 Cys 0.3 139 Cys 1.18 Cys 1.18 Cys 1.18 Cys ... primary amino acid chain: hydrophi licity (Hopp-Woods), surface probability (Emini), flexibility of < /b> the protein backbone (Karplus- Schulz), and secondary structure prediction (Chou-Fas...

Ngày tải lên: 12/08/2014, 02:20

... Fairclough D, Bacchus R, Ring C, Garson J. Hepatitis < /b> C virus in Egyptian blood donors in Riyadh. Lancet 1991; 33: 359-60. 18. Darwish NM, et al. Hepatitis < /b> C virus infection in blood donors in ... spoons, and rinsing liquids that may be used in association with needle drug use. Patients should be counseled on contaminated equipment being a source of <...

Ngày tải lên: 02/11/2012, 09:56

... roper structuring of < /b> a conformational epitope. DISCUSSION Increasing temperature greatly facilitated proteolytic attack of < /b> BLG by both trypsin and chymotrypsin. However, no ÔnovelÕ hydrolysis sites ... highly speci c; and (d) t hey act on complementary s ets of < /b> amino acids (hydrophobic, chymotrypsin; basic, trypsin). Other enzymes were tested, but their action was n...

Ngày tải lên: 21/02/2014, 15:20

... 150 lg bovine serum albumin and increasing concentrations of < /b> single dNTP), and were incubated at 37 C. The reaction was terminated by the addition of < /b> EDTA to a final concentration of < /b> 50 m M in 95% ... form- amide buffer. Reaction products were denatured by incu- bating at 95 C for 3 min and analyzed by electrophoresis in 16% polyacrylamide/7 M urea gels. Analysi...

Ngày tải lên: 31/03/2014, 01:20