Báo cáo y học: "No observed effect of homologous recombination on influenza C virus evolution" pptx
Báo cáo y học: "No observed effect of homologous recombination on influenza C virus evolution" pptx
... Open Access No observed effect of homologous recombination on influenza C virus evolution Guan-Zhu Han 1,4* , Maciej F Boni 2,3 , Si-Shen Li 1* Abstract The occurrence of homologous recombination ... influenza C viruses. Conclusion In our study, no homologous recombination signal was found in influenza C virus. Given the prese nt evidence, homologous re...
Ngày tải lên: 12/08/2014, 01:21
Tài liệu Báo cáo Y học: Dissecting the effect of trifluoroethanol on ribonuclease A Subtle structural changes detected by nonspecific proteases ppt
... induction of secondary structure as detected by far-UV circular dichroism spectroscopy. Prote- olysis with the nonspeci c proteases subtilisin Carlsberg or proteinase K, both of which attack native ... trifluoroethanol concentration. At > 30% (v/v) trifluoroethanol (pH 8.0; 25 C) , circular dichroism and fluorescence spectroscopy indicate a cooperative col- lapse of the tertiary struct...
Ngày tải lên: 22/02/2014, 07:20
Báo cáo y học: "Modeling the effect of levothyroxine therapy on bone mass density in postmenopausal women: a different approach leads to new inference" pot
... 3 of 11 (page number not for citation purposes) gender, race, family and personal medical history, diet, hormonal changes, medications, alcohol ingestion, phys- ical activity, medical conditions ... densitom- etry or biochemical markers during the first year of treatment can predict the degree of reduction of BMD. Our models' predictions of the time of maximum rate of chang...
Ngày tải lên: 13/08/2014, 16:21
Báo cáo y học: "No increased risk of infant hypospadias after maternal use of loratadine in early pregnancy"
... pregnancy, drug safety. 1. Introduction In a recent issue of International Journal of Medical Sciences, a study was published based on a prescription register in Denmark which indicated an ... (prescription or over-the counter) and to study offspring for various characteristics, including congenital malformations. Outcome is based on the recording of the attending paediatrici...
Ngày tải lên: 31/10/2012, 17:03
Báo cáo y học: "he combined effect of gender and age on post traumatic stress disorder: do men and women show differences in the lifespan distribution of the disorder" potx
... differences in the psychological consequences of hurricane Hugo. Psychol Aging 1993, 8:606-616. 13. Norris FH, Kaniasty K, Conrad ML, Inman GL, Murphy AD: Placing age differences in cultural context: ... BioMed Central and take full advantage of: • Convenient online submission • Thorough peer review • No space constraints or color figure charges • Immediate publication on acceptance • In...
Ngày tải lên: 09/08/2014, 01:21
Báo cáo y học: "The protective effect of licofelone on experimental osteoarthritis is correlated with the downregulation of gene expression and protein synthesis of several major cartilage catabolic factors: MMP-13, cathepsin K and aggrecanase" docx
... 5'-TGCGTTCCAGTGACTTCCAC Rv: 5'-CTCTGCACCATCTGCACGTG ADAMTS-4 Fw: 5'-TACTACTATGTGCTGGAGCC Rv: 5'-AGTGACCACATTGTTGTATCC ADAMTS-5 Fw: 5'-GGCATCATTCATGTGACAC Rv: 5'-GCATCGTAGGTCTGTCCTG GAPDH ... subchondral bone [18], which might explain its effect of inhibiting the remodeling of these tissues. The exact mechanisms by which licofelone could reduce MMP-13 expres...
Ngày tải lên: 09/08/2014, 06:23
Báo cáo y học: "Anti-inflammatory effect of antidiabetic thiazolidinediones prevents bone resorption rather than cartilage changes in experimental polyarthritis" pps
... 5'-AAGATGGGTCACCAGCAGCTCTACTG-3' 67 59 Antisense: 5'-AGACGCGGCAAGAGCGAGAA-3' Aggrecan Sense: 5'-ACACCCCTACCCTTGCTTCT-3' 124 58 Antisense: 5'-AAAGTGTCCAAGGCATCCAC-3' PPAR-α ... 5'-GGTAATTTCTTGTGAAGTGCT-3' Adiponectin Sense: 5'-AATCCTGCCCAGTCATGAAG-3' 433 58 Antisense: 5'-TCTCCAGGAGTGCCATCTCT-3' ACO Sense: 5'-CCAATCACGCA...
Ngày tải lên: 09/08/2014, 10:22
Báo cáo y học: "Assessing the effect of HAART on change in quality of life among HIV-infected women." pdf
... propensity score was obtained for each par- ticipant at each visit conditional on a number of variables, including age, education, race/ethnicity, income, employ- ment, health insurance, CD4+ cell counts, ... The Connie Wofsy Study Consortium of Northern California (Ruth Greenblatt); Los Angeles County/Southern California Consortium (Alexandra Levine); Chicago Consortium (Mardge Cohen...
Ngày tải lên: 10/08/2014, 05:20
Báo cáo y học: " Partial protective effect of CCR5-Delta 32 heterozygosity in a cohort of heterosexual Italian HIV-1 exposed uninfected individuals" pdf
... amplified by two primer pairs (CCR5-F1: 5'ATGGAGGGCAACTAAATACATT3'; CCR5-R1: 5'AGATGACTATCTTTAATGTCTG3'; CCR5-F2: 5'CTCTCATTTTCCATACAGTCAGTATCA3'; CCR5-R2: 5'AAGCCATGTGCACAACTCTGACTG3') ... mutation was obtained by using primers CD45-F: 5'-GATTGACTACAG- CAAAGATGCCC-3' and CD45-R: 5'-CCTCTGTGGTAT- TAAAAGCACTAGCA-3'; subsequent HpaII d...
Ngày tải lên: 10/08/2014, 05:20
Báo cáo y học: "Dose dependent effect of statins on postoperative atrial fibrillation after cardiac surgery among patients treated with beta blockers" docx
... is possible that the effect of statins on AF is dependent upon the duration of statin-therapy. Conclusion In conclusion, in this large cohort of cardiac surgery patients who were routinely treated with ... ventricular function, peripheral and cerebral vascular disease, smoking status, history of myocardial infarction, New York Heart Association functional class, beta blocker treat...
Ngày tải lên: 10/08/2014, 10:20